\
| Variant ID: vg0917361897 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 17361897 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTACATTTTCAAACTCAACAACTTGAGAGTTATTCATGATTTATATTCTCAAGGTTTGACTTGAACATTGTCCTAAACGACTTCCTTTACGAGTACGGAG[A/G]
GAGTATTTCAGAACAAATCCTGAGGGCTTTTGGGACGGAGGGAGTATTATATTTAAGCACCATGCAAGCATGCTAGATTATCTATAATTTAATAATTTAT
ATAAATTATTAAATTATAGATAATCTAGCATGCTTGCATGGTGCTTAAATATAATACTCCCTCCGTCCCAAAAGCCCTCAGGATTTGTTCTGAAATACTC[T/C]
CTCCGTACTCGTAAAGGAAGTCGTTTAGGACAATGTTCAAGTCAAACCTTGAGAATATAAATCATGAATAACTCTCAAGTTGTTGAGTTTGAAAATGTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.50% | 35.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 0.70% | 99.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.20% | 99.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 96.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 88.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 61.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0917361897 | A -> G | LOC_Os09g28540.1 | upstream_gene_variant ; 4519.0bp to feature; MODIFIER | silent_mutation | Average:21.032; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0917361897 | A -> G | LOC_Os09g28550.1 | upstream_gene_variant ; 1624.0bp to feature; MODIFIER | silent_mutation | Average:21.032; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0917361897 | A -> G | LOC_Os09g28560.1 | downstream_gene_variant ; 4510.0bp to feature; MODIFIER | silent_mutation | Average:21.032; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0917361897 | A -> G | LOC_Os09g28550-LOC_Os09g28560 | intergenic_region ; MODIFIER | silent_mutation | Average:21.032; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0917361897 | NA | 8.13E-33 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 5.00E-30 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.78E-36 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 3.11E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 8.29E-42 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.34E-26 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.19E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.94E-28 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 5.41E-23 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 6.41E-44 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.31E-52 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.92E-31 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.35E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 9.25E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 5.34E-19 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.63E-21 | mr1254 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.12E-30 | mr1256 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.96E-33 | mr1333 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.52E-23 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 8.46E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.26E-37 | mr1601 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 6.63E-11 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 3.22E-42 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 5.80E-35 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 5.50E-39 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 7.57E-30 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 3.57E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.16E-21 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.23E-57 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.77E-69 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 6.49E-27 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 4.38E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.08E-61 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.43E-41 | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 9.11E-28 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.23E-41 | mr1075_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 4.97E-32 | mr1081_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.70E-35 | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 7.08E-59 | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 9.66E-29 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.26E-33 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.66E-23 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.00E-33 | mr1256_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 3.89E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 9.98E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 4.05E-29 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.91E-23 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 1.08E-16 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 6.39E-11 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 8.02E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 4.09E-19 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 8.11E-36 | mr1689_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 2.24E-52 | mr1861_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 4.55E-89 | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0917361897 | NA | 3.01E-35 | mr1878_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |