\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917280218:

Variant ID: vg0917280218 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17280218
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAATAACTTTGTGTAAATCCGGTTATATCGAATTCAAGTCCTCGATCAGAAACATGACGCCACTTATATTCGGATAAGAGCCAACGAGTCTGTTGGTAA[T/C]
TTTTTGTGACAAGTCGACAAGCACGATCGCAACACCTAAACGCCTTGCGGTGATATGTAGTCGCCAACCACCTCGATCTAGCCAAAGGGCCAATGAACCG

Reverse complement sequence

CGGTTCATTGGCCCTTTGGCTAGATCGAGGTGGTTGGCGACTACATATCACCGCAAGGCGTTTAGGTGTTGCGATCGTGCTTGTCGACTTGTCACAAAAA[A/G]
TTACCAACAGACTCGTTGGCTCTTATCCGAATATAAGTGGCGTCATGTTTCTGATCGAGGACTTGAATTCGATATAACCGGATTTACACAAAGTTATTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 32.40% 0.17% 3.15% NA
All Indica  2759 98.60% 1.10% 0.00% 0.33% NA
All Japonica  1512 0.60% 90.00% 0.40% 8.99% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.00% 0.17% NA
Indica II  465 96.30% 3.40% 0.00% 0.22% NA
Indica III  913 99.50% 0.30% 0.00% 0.22% NA
Indica Intermediate  786 98.30% 1.00% 0.00% 0.64% NA
Temperate Japonica  767 0.30% 98.30% 0.13% 1.30% NA
Tropical Japonica  504 0.20% 76.20% 0.40% 23.21% NA
Japonica Intermediate  241 2.50% 92.50% 1.24% 3.73% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 35.60% 57.80% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917280218 T -> DEL N N silent_mutation Average:76.684; most accessible tissue: Callus, score: 97.793 N N N N
vg0917280218 T -> C LOC_Os09g28390-LOC_Os09g28400 intergenic_region ; MODIFIER silent_mutation Average:76.684; most accessible tissue: Callus, score: 97.793 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0917280218 T C -0.03 -0.02 -0.03 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917280218 NA 3.72E-36 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 8.88E-39 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 5.72E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 6.83E-59 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 1.42E-50 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 2.20E-46 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 3.34E-40 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 1.80E-27 mr1571 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 5.80E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 1.72E-38 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 2.45E-39 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 2.19E-60 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 4.47E-36 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 3.46E-40 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 1.48E-68 mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 1.18E-41 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 1.97E-53 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 1.61E-35 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 5.71E-39 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 8.45E-76 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 8.40E-35 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 1.01E-13 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 1.20E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 1.21E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917280218 NA 7.73E-43 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251