Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917229617:

Variant ID: vg0917229617 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 17229617
Reference Allele: ATC	Alternative Allele: CTC,A
Primary Allele: CTC	Secondary Allele: ATC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTTGCCAAATTATCCTTAGTTAACACAACCCCTTTAAGCAGGTACCACATGAAAATTTTAATTTTAAGTGGCAACTTAAGCTTCCAAATACACTTGTTT[ATC/CTC,A]
TCGATATAGCCATTATTAATTAAAGCTAGGTACATAGACCTCACCGAGAACAAGCCATTCTGATGGAAATTCCATCTAAATCTATCAGACGAATCATTCA

Reverse complement sequence

TGAATGATTCGTCTGATAGATTTAGATGGAATTTCCATCAGAATGGCTTGTTCTCGGTGAGGTCTATGTACCTAGCTTTAATTAATAATGGCTATATCGA[GAT/GAG,T]
AAACAAGTGTATTTGGAAGCTTAAGTTGCCACTTAAAATTAAAATTTTCATGTGGTACCTGCTTAAAGGGGTTGTGTTAACTAAGGATAATTTGGCAAGG

Allele Frequencies:

Populations	Population Size	Frequency of CTC(primary allele)	Frequency of ATC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	35.70%	0.49%	0.13%	A: 0.02%
All Indica	2759	97.50%	1.70%	0.54%	0.18%	A: 0.04%
All Japonica	1512	0.90%	99.10%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	94.40%	3.90%	1.51%	0.22%	NA
Indica III	913	98.70%	0.80%	0.22%	0.22%	A: 0.11%
Indica Intermediate	786	97.30%	1.70%	0.76%	0.25%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.30%	0.41%	0.00%	NA
VI/Aromatic	96	8.30%	88.50%	3.12%	0.00%	NA
Intermediate	90	32.20%	62.20%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0917229617	ATC -> DEL	N	N	silent_mutation	Average:40.877; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg0917229617	ATC -> A	LOC_Os09g28354.1	downstream_gene_variant ; 657.0bp to feature; MODIFIER	silent_mutation	Average:40.877; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg0917229617	ATC -> A	LOC_Os09g28370.1	downstream_gene_variant ; 1680.0bp to feature; MODIFIER	silent_mutation	Average:40.877; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg0917229617	ATC -> A	LOC_Os09g28354-LOC_Os09g28370	intergenic_region ; MODIFIER	silent_mutation	Average:40.877; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg0917229617	ATC -> CTC	LOC_Os09g28354.1	downstream_gene_variant ; 656.0bp to feature; MODIFIER	silent_mutation	Average:40.877; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg0917229617	ATC -> CTC	LOC_Os09g28370.1	downstream_gene_variant ; 1681.0bp to feature; MODIFIER	silent_mutation	Average:40.877; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg0917229617	ATC -> CTC	LOC_Os09g28354-LOC_Os09g28370	intergenic_region ; MODIFIER	silent_mutation	Average:40.877; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0917229617	NA	1.67E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229617	NA	9.63E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229617	NA	5.05E-12	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229617	NA	1.63E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229617	NA	1.78E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229617	NA	1.28E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229617	NA	3.83E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229617	3.76E-06	NA	mr1514_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917229617	NA	5.41E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251