RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0917115951:

Variant ID: vg0917115951 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 17115951
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAACAATACAAGCGTTACAAGTACATCAATACTTGATGGTGGCATTTATACTAATTTGATTGAGGGACCACATTGTCAGTTGATTTTTGCGGGTAAAC[A/G]
GGCGAAGCGGGCATATGTAGTGACTACCCATGCCCGAGCCCGTATGCCCGTTGGGTATAGGTTTTGACCCAATAAAAACTCATGGGGTACTAAATAGAGA

Reverse complement sequence

TCTCTATTTAGTACCCCATGAGTTTTTATTGGGTCAAAACCTATACCCAACGGGCATACGGGCTCGGGCATGGGTAGTCACTACATATGCCCGCTTCGCC[T/C]
GTTTACCCGCAAAAATCAACTGACAATGTGGTCCCTCAATCAAATTAGTATAAATGCCACCATCAAGTATTGATGTACTTGTAACGCTTGTATTGTTGAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.30%	15.70%	0.04%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	53.60%	46.30%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	23.10%	76.70%	0.26%	0.00%	NA
Tropical Japonica	504	94.60%	5.40%	0.00%	0.00%	NA
Japonica Intermediate	241	64.70%	35.30%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0917115951	A -> G	LOC_Os09g28200.1	upstream_gene_variant ; 4874.0bp to feature; MODIFIER	silent_mutation	Average:48.405; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0917115951	A -> G	LOC_Os09g28200-LOC_Os09g28210	intergenic_region ; MODIFIER	silent_mutation	Average:48.405; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0917115951	3.93E-09	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0917115951	NA	5.43E-13	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917115951	NA	9.14E-12	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917115951	NA	3.75E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917115951	NA	1.45E-10	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917115951	NA	3.22E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917115951	NA	1.47E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917115951	NA	3.70E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917115951	NA	5.35E-11	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917115951	NA	1.42E-10	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 14 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0917115951:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact