\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917084640:

Variant ID: vg0917084640 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17084640
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, G: 0.26, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGCCAGGTCTTTTTTTCGAATGGTAAGGCCGTTGCCGACGTTTTATATTAAGAAGAAGGTGTCCCATTTTAAGAAGCAAACGAGACCAAACCTTACAG[G/T]
GTCCAGTTAATTAGGGAAAACTGAACGAAAACCACAGCTACAACACCATGCTAACAACTAACCTAACCTAAACTACCACGACGGAGCCCGACACAAGGCA

Reverse complement sequence

TGCCTTGTGTCGGGCTCCGTCGTGGTAGTTTAGGTTAGGTTAGTTGTTAGCATGGTGTTGTAGCTGTGGTTTTCGTTCAGTTTTCCCTAATTAACTGGAC[C/A]
CTGTAAGGTTTGGTCTCGTTTGCTTCTTAAAATGGGACACCTTCTTCTTAATATAAAACGTCGGCAACGGCCTTACCATTCGAAAAAAAGACCTGGCTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 20.00% 0.00% 0.00% NA
All Indica  2759 97.40% 2.60% 0.00% 0.00% NA
All Japonica  1512 67.60% 32.40% 0.00% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.50% 0.00% 0.00% NA
Temperate Japonica  767 94.40% 5.60% 0.00% 0.00% NA
Tropical Japonica  504 16.70% 83.30% 0.00% 0.00% NA
Japonica Intermediate  241 88.80% 11.20% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917084640 G -> T LOC_Os09g28150.1 upstream_gene_variant ; 4996.0bp to feature; MODIFIER silent_mutation Average:61.141; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg0917084640 G -> T LOC_Os09g28160.1 downstream_gene_variant ; 1072.0bp to feature; MODIFIER silent_mutation Average:61.141; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg0917084640 G -> T LOC_Os09g28160-LOC_Os09g28170 intergenic_region ; MODIFIER silent_mutation Average:61.141; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917084640 NA 1.75E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 1.03E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 4.52E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 1.51E-11 mr1530 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 1.98E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 8.32E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 9.87E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 6.60E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 7.04E-14 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 5.59E-16 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 2.08E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 2.03E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 1.45E-18 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 7.67E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 5.11E-16 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 1.40E-11 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917084640 NA 9.66E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251