\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916974525:

Variant ID: vg0916974525 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16974525
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTAATTAGGCTTAATAAATTCGTCTCGCAGTTTCCTGGCGGAATCTGTAATTTGATTTATTATTATACTACGTTTAATACTTTAAATGTGTGTCTGT[A/G]
TATCCGATGTGATATGCAGGGGCAAAAAAATTTTTTTTGCCAACTAATCAGGCCCTTAGTCGCTACTATTTATTTGAAACGGTGCAGATCAGCAGATCGG

Reverse complement sequence

CCGATCTGCTGATCTGCACCGTTTCAAATAAATAGTAGCGACTAAGGGCCTGATTAGTTGGCAAAAAAAATTTTTTTGCCCCTGCATATCACATCGGATA[T/C]
ACAGACACACATTTAAAGTATTAAACGTAGTATAATAATAAATCAAATTACAGATTCCGCCAGGAAACTGCGAGACGAATTTATTAAGCCTAATTAATCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 45.60% 0.02% 0.00% NA
All Indica  2759 23.20% 76.80% 0.04% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 52.10% 47.70% 0.17% 0.00% NA
Indica II  465 12.70% 87.30% 0.00% 0.00% NA
Indica III  913 4.20% 95.80% 0.00% 0.00% NA
Indica Intermediate  786 29.60% 70.40% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916974525 A -> G LOC_Os09g27920.1 upstream_gene_variant ; 1236.0bp to feature; MODIFIER silent_mutation Average:62.464; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0916974525 A -> G LOC_Os09g27940.1 upstream_gene_variant ; 2957.0bp to feature; MODIFIER silent_mutation Average:62.464; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0916974525 A -> G LOC_Os09g27940.2 upstream_gene_variant ; 2957.0bp to feature; MODIFIER silent_mutation Average:62.464; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0916974525 A -> G LOC_Os09g27910.1 downstream_gene_variant ; 2793.0bp to feature; MODIFIER silent_mutation Average:62.464; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0916974525 A -> G LOC_Os09g27930.1 intron_variant ; MODIFIER silent_mutation Average:62.464; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916974525 NA 5.75E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 1.52E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 1.40E-18 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 9.89E-12 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 5.12E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 3.05E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 3.21E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 4.38E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 1.41E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 5.68E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 2.20E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 6.17E-08 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 5.11E-11 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 2.13E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 1.39E-08 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 3.01E-06 3.97E-19 mr1138_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 5.54E-06 1.01E-11 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 2.94E-19 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 9.77E-15 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 2.53E-46 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 8.39E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 1.63E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 1.28E-10 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 4.63E-09 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 8.61E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525 NA 5.18E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251