Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916974525:

Variant ID: vg0916974525 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16974525
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

AGATTAATTAGGCTTAATAAATTCGTCTCGCAGTTTCCTGGCGGAATCTGTAATTTGATTTATTATTATACTACGTTTAATACTTTAAATGTGTGTCTGT[A/G]
TATCCGATGTGATATGCAGGGGCAAAAAAATTTTTTTTGCCAACTAATCAGGCCCTTAGTCGCTACTATTTATTTGAAACGGTGCAGATCAGCAGATCGG

Reverse complement sequence

CCGATCTGCTGATCTGCACCGTTTCAAATAAATAGTAGCGACTAAGGGCCTGATTAGTTGGCAAAAAAAATTTTTTTGCCCCTGCATATCACATCGGATA[T/C]
ACAGACACACATTTAAAGTATTAAACGTAGTATAATAATAAATCAAATTACAGATTCCGCCAGGAAACTGCGAGACGAATTTATTAAGCCTAATTAATCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.40%	45.60%	0.02%	0.00%	NA
All Indica	2759	23.20%	76.80%	0.04%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	52.10%	47.70%	0.17%	0.00%	NA
Indica II	465	12.70%	87.30%	0.00%	0.00%	NA
Indica III	913	4.20%	95.80%	0.00%	0.00%	NA
Indica Intermediate	786	29.60%	70.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916974525	A -> G	LOC_Os09g27920.1	upstream_gene_variant ; 1236.0bp to feature; MODIFIER	silent_mutation	Average:62.464; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0916974525	A -> G	LOC_Os09g27940.1	upstream_gene_variant ; 2957.0bp to feature; MODIFIER	silent_mutation	Average:62.464; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0916974525	A -> G	LOC_Os09g27940.2	upstream_gene_variant ; 2957.0bp to feature; MODIFIER	silent_mutation	Average:62.464; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0916974525	A -> G	LOC_Os09g27910.1	downstream_gene_variant ; 2793.0bp to feature; MODIFIER	silent_mutation	Average:62.464; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0916974525	A -> G	LOC_Os09g27930.1	intron_variant ; MODIFIER	silent_mutation	Average:62.464; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916974525	NA	5.75E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	1.52E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	1.40E-18	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	9.89E-12	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	5.12E-06	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	3.05E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	3.21E-08	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	4.38E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	1.41E-06	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	5.68E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	2.20E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	6.17E-08	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	5.11E-11	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	2.13E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	1.39E-08	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	3.01E-06	3.97E-19	mr1138_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	5.54E-06	1.01E-11	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	2.94E-19	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	9.77E-15	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	2.53E-46	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	8.39E-06	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	1.63E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	1.28E-10	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	4.63E-09	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	8.61E-07	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916974525	NA	5.18E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251