\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916922179:

Variant ID: vg0916922179 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16922179
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGTCGGGGTTGGCACTAGAGAGTGGAACGATCTTGATTGCGGAGTCCAGTTTCGGCGTCTTGTTTGTCTTTCTCACTTTCTTGGGTGACTCAGCTGTG[G/A]
TAGGTGGGCTGGGCGTAGGGGTGAAAACGGTTCAGATTTTTTCCGGATTCCGGACCTGTTTTCGAAAACGGAATCAGCCGGTCGAAATTTCTCGGAAACG

Reverse complement sequence

CGTTTCCGAGAAATTTCGACCGGCTGATTCCGTTTTCGAAAACAGGTCCGGAATCCGGAAAAAATCTGAACCGTTTTCACCCCTACGCCCAGCCCACCTA[C/T]
CACAGCTGAGTCACCCAAGAAAGTGAGAAAGACAAACAAGACGCCGAAACTGGACTCCGCAATCAAGATCGTTCCACTCTCTAGTGCCAACCCCGACAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 46.60% 0.28% 0.00% NA
All Indica  2759 21.40% 78.50% 0.11% 0.00% NA
All Japonica  1512 99.40% 0.30% 0.33% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 51.30% 48.40% 0.34% 0.00% NA
Indica II  465 8.60% 91.40% 0.00% 0.00% NA
Indica III  913 3.60% 96.40% 0.00% 0.00% NA
Indica Intermediate  786 27.00% 72.90% 0.13% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 99.20% 0.20% 0.60% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 67.80% 27.80% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916922179 G -> A LOC_Os09g27820.1 upstream_gene_variant ; 3278.0bp to feature; MODIFIER silent_mutation Average:38.702; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0916922179 G -> A LOC_Os09g27800.1 downstream_gene_variant ; 4005.0bp to feature; MODIFIER silent_mutation Average:38.702; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0916922179 G -> A LOC_Os09g27810.1 intron_variant ; MODIFIER silent_mutation Average:38.702; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916922179 NA 1.87E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 3.04E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 1.47E-07 4.88E-20 mr1138 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 2.75E-07 4.20E-13 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 2.46E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 7.22E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 3.26E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 3.01E-08 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 9.32E-07 NA mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 7.91E-06 4.53E-12 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 3.24E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 2.87E-09 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 1.29E-06 8.08E-19 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 1.29E-06 4.14E-11 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 3.10E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 7.46E-20 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 4.96E-16 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 2.71E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 4.28E-06 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 2.93E-11 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 9.60E-10 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 1.22E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 3.46E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916922179 NA 9.73E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251