\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916892004:

Variant ID: vg0916892004 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16892004
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCGCGCAGCAGGAGGAGACAGCAAGGCCATGGCAAATTATCTGCCTGTGGCCCTAGCGGACTCCGCCCGATCCTGGCTCCACGGACTACCCTGTGGCA[C/T]
GATCAGATCATGGGCGGAACTTCGTGATCACTTCATCGCCAACTTCCAGGGCACCTTTGAACGCCCCGGCACACAGTTTGATCTCTACAACATCGTTCAG

Reverse complement sequence

CTGAACGATGTTGTAGAGATCAAACTGTGTGCCGGGGCGTTCAAAGGTGCCCTGGAAGTTGGCGATGAAGTGATCACGAAGTTCCGCCCATGATCTGATC[G/A]
TGCCACAGGGTAGTCCGTGGAGCCAGGATCGGGCGGAGTCCGCTAGGGCCACAGGCAGATAATTTGCCATGGCCTTGCTGTCTCCTCCTGCTGCGCGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 8.90% 0.32% 0.00% NA
All Indica  2759 99.70% 0.20% 0.04% 0.00% NA
All Japonica  1512 72.60% 26.70% 0.73% 0.00% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 24.20% 73.80% 1.98% 0.00% NA
Japonica Intermediate  241 94.20% 5.40% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916892004 C -> T LOC_Os09g27760.1 missense_variant ; p.Thr442Met; MODERATE nonsynonymous_codon ; T442M Average:32.697; most accessible tissue: Zhenshan97 flower, score: 47.586 unknown unknown DELETERIOUS 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916892004 9.65E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 NA 2.37E-07 mr1408 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 NA 3.93E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 NA 1.26E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 9.62E-06 NA mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 5.99E-08 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 NA 9.23E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 2.03E-09 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 NA 2.49E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 1.96E-07 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 7.13E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 4.98E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 NA 1.34E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 1.09E-09 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 NA 6.34E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 3.51E-07 1.35E-10 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916892004 NA 3.68E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251