\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916819608:

Variant ID: vg0916819608 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16819608
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCTAGAGATAAGATAGAGTCCTAGAGATAAATCTACTCTTATTTGTATTGTACTCTAAGTCTCTATCCCCTATGTACTCTTATATATACCCCATGAGA[G/A]
GGTCGATGTAATAGATCAGAAAACACCAAAATACAACAATTAGATTTTTCCACATGGTATAAAGGAGAGTCAAGGGACGACACAGAAGATGACGCAGGCA

Reverse complement sequence

TGCCTGCGTCATCTTCTGTGTCGTCCCTTGACTCTCCTTTATACCATGTGGAAAAATCTAATTGTTGTATTTTGGTGTTTTCTGATCTATTACATCGACC[C/T]
TCTCATGGGGTATATATAAGAGTACATAGGGGATAGAGACTTAGAGTACAATACAAATAAGAGTAGATTTATCTCTAGGACTCTATCTTATCTCTAGGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 17.60% 0.19% 0.21% NA
All Indica  2759 98.60% 1.30% 0.00% 0.07% NA
All Japonica  1512 65.90% 33.70% 0.33% 0.00% NA
Aus  269 21.90% 74.70% 0.37% 2.97% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 2.90% 0.00% 0.25% NA
Temperate Japonica  767 93.60% 6.10% 0.26% 0.00% NA
Tropical Japonica  504 13.90% 85.70% 0.40% 0.00% NA
Japonica Intermediate  241 86.70% 12.90% 0.41% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 74.40% 22.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916819608 G -> DEL N N silent_mutation Average:47.902; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0916819608 G -> A LOC_Os09g27650.2 upstream_gene_variant ; 2626.0bp to feature; MODIFIER silent_mutation Average:47.902; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0916819608 G -> A LOC_Os09g27650.1 upstream_gene_variant ; 2626.0bp to feature; MODIFIER silent_mutation Average:47.902; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0916819608 G -> A LOC_Os09g27640-LOC_Os09g27650 intergenic_region ; MODIFIER silent_mutation Average:47.902; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916819608 NA 7.20E-09 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 2.20E-12 mr1047 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 1.39E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 4.45E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 3.14E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 5.56E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 2.61E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 1.10E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 2.87E-08 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 6.95E-11 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 5.16E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 6.00E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 1.96E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 2.75E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 1.78E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 5.86E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 7.52E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 1.12E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916819608 NA 1.33E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251