\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916795852:

Variant ID: vg0916795852 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16795852
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


CACATCACCTTAATTCAAATTTAGTATAACACCCGAGAACAGATCTACAAATGGCTAATGGATCCATACAAATGACTAGTGCATTTTACATGTATTACCA[C/T]
ATGGCAATTCAATTCAACGAGCGGGTGTGAATCGGGGTGAGAAATAATGAATATTTACCTTGTAGGCTTCAATCTTCAACCAAAACCTAAGAAAAATCGA

Reverse complement sequence

TCGATTTTTCTTAGGTTTTGGTTGAAGATTGAAGCCTACAAGGTAAATATTCATTATTTCTCACCCCGATTCACACCCGCTCGTTGAATTGAATTGCCAT[G/A]
TGGTAATACATGTAAAATGCACTAGTCATTTGTATGGATCCATTAGCCATTTGTAGATCTGTTCTCGGGTGTTATACTAAATTTGAATTAAGGTGATGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 6.30% 1.78% 1.59% NA
All Indica  2759 83.70% 10.70% 2.97% 2.68% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 53.30% 31.60% 7.73% 7.39% NA
Indica II  465 95.70% 2.20% 1.08% 1.08% NA
Indica III  913 99.10% 0.30% 0.11% 0.44% NA
Indica Intermediate  786 81.60% 12.00% 3.82% 2.67% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 2.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916795852 C -> DEL N N silent_mutation Average:36.506; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0916795852 C -> T LOC_Os09g27640.1 downstream_gene_variant ; 4100.0bp to feature; MODIFIER silent_mutation Average:36.506; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0916795852 C -> T LOC_Os09g27620-LOC_Os09g27640 intergenic_region ; MODIFIER silent_mutation Average:36.506; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916795852 2.72E-11 NA mr1138 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 2.11E-10 3.36E-15 mr1138 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 NA 5.86E-09 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 NA 9.07E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 2.94E-10 1.61E-21 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 1.82E-08 3.07E-14 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 6.54E-16 2.64E-29 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 6.59E-13 6.66E-20 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 3.07E-07 1.47E-18 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 6.59E-07 3.27E-13 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 2.05E-09 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 1.25E-07 1.12E-12 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 NA 4.74E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 NA 7.26E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 6.73E-09 2.20E-16 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 3.97E-07 3.16E-10 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 3.40E-14 6.84E-32 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 7.65E-11 2.86E-19 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 2.66E-09 7.01E-22 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916795852 2.57E-08 1.76E-15 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251