\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916776579:

Variant ID: vg0916776579 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16776579
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGACCAAACCCTATCCATATCTACGTCTCTCCCCGTATTCCGTCTCTCTCTCTGAGTGCTGGTGGTGGCGGTGGCTCGTGGAGGGAGAGTGGCGGCGACC[G/A]
CGAGGTGCGGCGGCGGCGGCGGCTCGTGGAGGGAGGGAGGGGATCCGCATGGCGCTGGCTCGCGGAGGGAGGAGCGGCGACGCCGGCCTGTGGAGGGAGG

Reverse complement sequence

CCTCCCTCCACAGGCCGGCGTCGCCGCTCCTCCCTCCGCGAGCCAGCGCCATGCGGATCCCCTCCCTCCCTCCACGAGCCGCCGCCGCCGCCGCACCTCG[C/T]
GGTCGCCGCCACTCTCCCTCCACGAGCCACCGCCACCACCAGCACTCAGAGAGAGAGACGGAATACGGGGAGAGACGTAGATATGGATAGGGTTTGGTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 4.30% 1.27% 0.00% NA
All Indica  2759 90.60% 7.30% 2.14% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 70.30% 23.00% 6.72% 0.00% NA
Indica II  465 97.00% 2.60% 0.43% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 91.50% 6.50% 2.04% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916776579 G -> A LOC_Os09g27610.1 upstream_gene_variant ; 4573.0bp to feature; MODIFIER silent_mutation Average:61.737; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0916776579 G -> A LOC_Os09g27590-LOC_Os09g27610 intergenic_region ; MODIFIER silent_mutation Average:61.737; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916776579 2.59E-07 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 2.58E-06 1.79E-10 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 8.41E-16 5.27E-28 mr1707 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 4.67E-12 1.77E-18 mr1707 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 1.62E-16 1.84E-31 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 2.51E-13 1.57E-22 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 1.31E-07 5.09E-17 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 4.42E-07 2.29E-12 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 7.68E-10 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 4.17E-08 7.51E-12 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 NA 1.13E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 1.82E-14 4.52E-25 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 1.23E-10 6.24E-16 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 8.65E-19 1.53E-40 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 5.52E-14 1.86E-26 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 4.97E-12 1.68E-24 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 2.12E-10 1.76E-18 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 NA 3.96E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916776579 NA 8.64E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251