Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916695636:

Variant ID: vg0916695636 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16695636
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGGTGTGGATAGTCCAAACCGCGATTCGCTTAACCGAACTAGGTAGTATACGTGCAAAACGGATATTTTACATTTGAGTAAATTTTAAGAAACTACAT[G/A]
TACGTTATCAATCTATCACAAAACTATAAATTTAGTATCGGTTTTATCATAGAGTTACAACTTTTACAACCCCAACATGTTATGAATATAAACTAAAAAA

Reverse complement sequence

TTTTTTAGTTTATATTCATAACATGTTGGGGTTGTAAAAGTTGTAACTCTATGATAAAACCGATACTAAATTTATAGTTTTGTGATAGATTGATAACGTA[C/T]
ATGTAGTTTCTTAAAATTTACTCAAATGTAAAATATCCGTTTTGCACGTATACTACCTAGTTCGGTTAAGCGAATCGCGGTTTGGACTATCCACACCCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 2.90% 0.06% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 96.90% 3.00% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.70% 0.00% 0.00% NA
Temperate Japonica  767 95.70% 4.00% 0.26% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 57.30% 41.70% 1.04% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916695636 G -> A LOC_Os09g27480.1 downstream_gene_variant ; 535.0bp to feature; MODIFIER silent_mutation Average:76.139; most accessible tissue: Minghui63 panicle, score: 93.294 N N N N
vg0916695636 G -> A LOC_Os09g27470-LOC_Os09g27480 intergenic_region ; MODIFIER silent_mutation Average:76.139; most accessible tissue: Minghui63 panicle, score: 93.294 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0916695636 G A -0.02 -0.02 -0.02 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916695636 NA 2.23E-19 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0916695636 NA 8.73E-14 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0916695636 8.36E-08 8.36E-08 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916695636 5.08E-07 5.08E-07 mr1009 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916695636 9.88E-07 9.88E-07 mr1014 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916695636 NA 2.16E-06 mr1465_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916695636 9.96E-06 2.01E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251