Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916644408:

Variant ID: vg0916644408 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16644408
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TGTATGACTTACCTTTGGAATTCATTCCTATATAATATCTCAGATGACATAACATATATAAATCAAACTGGTTAGAATTCTGAACACTGCTTCCAATTTT[T/C]
GATTAGTCAAGCGCCTTGCATGGTTATAAACATGCATATCAACATGAGGTAGCTGAATGATGTCACTAGTAAAAAAAGTGTTTACAATATTACTTTGCTC

Reverse complement sequence

GAGCAAAGTAATATTGTAAACACTTTTTTTACTAGTGACATCATTCAGCTACCTCATGTTGATATGCATGTTTATAACCATGCAAGGCGCTTGACTAATC[A/G]
AAAATTGGAAGCAGTGTTCAGAATTCTAACCAGTTTGATTTATATATGTTATGTCATCTGAGATATTATATAGGAATGAATTCCAAAGGTAAGTCATACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.80%	31.20%	0.93%	0.11%	NA
All Indica	2759	99.20%	0.60%	0.07%	0.07%	NA
All Japonica	1512	7.50%	89.70%	2.58%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.30%	1.50%	0.22%	0.00%	NA
Indica III	913	99.50%	0.30%	0.00%	0.22%	NA
Indica Intermediate	786	99.00%	0.90%	0.13%	0.00%	NA
Temperate Japonica	767	11.70%	83.30%	4.95%	0.00%	NA
Tropical Japonica	504	2.20%	97.80%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	93.40%	0.41%	0.83%	NA
VI/Aromatic	96	41.70%	58.30%	0.00%	0.00%	NA
Intermediate	90	45.60%	50.00%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916644408	T -> DEL	N	N	silent_mutation	Average:49.42; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0916644408	T -> C	LOC_Os09g27380.1	downstream_gene_variant ; 3582.0bp to feature; MODIFIER	silent_mutation	Average:49.42; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0916644408	T -> C	LOC_Os09g27390.1	downstream_gene_variant ; 135.0bp to feature; MODIFIER	silent_mutation	Average:49.42; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0916644408	T -> C	LOC_Os09g27400.1	downstream_gene_variant ; 4414.0bp to feature; MODIFIER	silent_mutation	Average:49.42; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0916644408	T -> C	LOC_Os09g27380-LOC_Os09g27390	intergenic_region ; MODIFIER	silent_mutation	Average:49.42; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916644408	NA	7.75E-26	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916644408	NA	1.94E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916644408	NA	1.76E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916644408	NA	3.44E-09	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916644408	2.05E-06	2.05E-06	mr1004_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251