\
| Variant ID: vg0916568531 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 16568531 |
| Reference Allele: C | Alternative Allele: CATAT,CAT,T,CATATAT,CATATATAT |
| Primary Allele: C | Secondary Allele: CATAT |
Inferred Ancestral Allele: Not determined.
TACTACTCCCATGTCTTACGTTATAAACGTTTTGGTCTCTTGATTTATAGTCTAACTCATTAACATCTGTATGATTATGCATATATTTATATATGAAACA[C/CATAT,CAT,T,CATATAT,CATATATAT]
ATATATACATGGATTCATACATGAATATGTTTAAAATCCGAAACATCTTATAATACGAAACAAAATAAGTATTCCCTCTATTTTTTAATTTTTTAATGTA
TACATTAAAAAATTAAAAAATAGAGGGAATACTTATTTTGTTTCGTATTATAAGATGTTTCGGATTTTAAACATATTCATGTATGAATCCATGTATATAT[G/ATATG,ATG,A,ATATATG,ATATATATG]
TGTTTCATATATAAATATATGCATAATCATACAGATGTTAATGAGTTAGACTATAAATCAAGAGACCAAAACGTTTATAACGTAAGACATGGGAGTAGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of CATAT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.00% | 29.10% | 4.66% | 0.00% | T: 16.57%; CAT: 16.10%; CATATAT: 0.59%; CATATATAT: 0.02% |
| All Indica | 2759 | 22.40% | 48.70% | 0.76% | 0.00% | CAT: 26.79%; CATATAT: 1.01%; T: 0.25%; CATATATAT: 0.04% |
| All Japonica | 1512 | 39.00% | 0.40% | 12.30% | 0.00% | T: 47.95%; CAT: 0.33% |
| Aus | 269 | 96.30% | 2.20% | 0.00% | 0.00% | CAT: 1.12%; T: 0.37% |
| Indica I | 595 | 50.30% | 43.00% | 1.34% | 0.00% | CATATAT: 3.19%; CAT: 2.02%; CATATATAT: 0.17% |
| Indica II | 465 | 14.20% | 29.20% | 0.65% | 0.00% | CAT: 55.48%; T: 0.43% |
| Indica III | 913 | 2.60% | 67.50% | 0.22% | 0.00% | CAT: 29.35%; CATATAT: 0.22%; T: 0.11% |
| Indica Intermediate | 786 | 29.30% | 42.70% | 1.02% | 0.00% | CAT: 25.57%; CATATAT: 0.89%; T: 0.51% |
| Temperate Japonica | 767 | 59.70% | 0.30% | 22.29% | 0.00% | T: 17.60%; CAT: 0.13% |
| Tropical Japonica | 504 | 9.70% | 0.40% | 1.19% | 0.00% | T: 88.29%; CAT: 0.40% |
| Japonica Intermediate | 241 | 34.40% | 0.80% | 3.73% | 0.00% | T: 60.17%; CAT: 0.83% |
| VI/Aromatic | 96 | 46.90% | 2.10% | 11.46% | 0.00% | T: 37.50%; CAT: 2.08% |
| Intermediate | 90 | 51.10% | 17.80% | 2.22% | 0.00% | T: 15.56%; CAT: 13.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916568531 | C -> CATATATAT | LOC_Os09g27250.1 | upstream_gene_variant ; 2454.0bp to feature; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CATATATAT | LOC_Os09g27260.1 | downstream_gene_variant ; 4968.0bp to feature; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CATATATAT | LOC_Os09g27250-LOC_Os09g27260 | intergenic_region ; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> T | LOC_Os09g27250.1 | upstream_gene_variant ; 2453.0bp to feature; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> T | LOC_Os09g27260.1 | downstream_gene_variant ; 4969.0bp to feature; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> T | LOC_Os09g27250-LOC_Os09g27260 | intergenic_region ; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CAT | LOC_Os09g27250.1 | upstream_gene_variant ; 2454.0bp to feature; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CAT | LOC_Os09g27260.1 | downstream_gene_variant ; 4968.0bp to feature; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CAT | LOC_Os09g27250-LOC_Os09g27260 | intergenic_region ; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CATAT | LOC_Os09g27250.1 | upstream_gene_variant ; 2454.0bp to feature; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CATAT | LOC_Os09g27260.1 | downstream_gene_variant ; 4968.0bp to feature; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CATAT | LOC_Os09g27250-LOC_Os09g27260 | intergenic_region ; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CATATAT | LOC_Os09g27250.1 | upstream_gene_variant ; 2454.0bp to feature; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CATATAT | LOC_Os09g27260.1 | downstream_gene_variant ; 4968.0bp to feature; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| vg0916568531 | C -> CATATAT | LOC_Os09g27250-LOC_Os09g27260 | intergenic_region ; MODIFIER | silent_mutation | Average:42.056; most accessible tissue: Callus, score: 73.69 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916568531 | NA | 6.19E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916568531 | 7.45E-07 | NA | mr1224_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916568531 | NA | 1.05E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916568531 | NA | 4.80E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916568531 | NA | 1.09E-07 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916568531 | NA | 1.32E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916568531 | NA | 8.97E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916568531 | NA | 6.26E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916568531 | NA | 9.17E-08 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916568531 | NA | 2.77E-08 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916568531 | NA | 3.39E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |