\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916568531:

Variant ID: vg0916568531 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 16568531
Reference Allele: CAlternative Allele: CATAT,CAT,T,CATATAT,CATATATAT
Primary Allele: CSecondary Allele: CATAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTACTCCCATGTCTTACGTTATAAACGTTTTGGTCTCTTGATTTATAGTCTAACTCATTAACATCTGTATGATTATGCATATATTTATATATGAAACA[C/CATAT,CAT,T,CATATAT,CATATATAT]
ATATATACATGGATTCATACATGAATATGTTTAAAATCCGAAACATCTTATAATACGAAACAAAATAAGTATTCCCTCTATTTTTTAATTTTTTAATGTA

Reverse complement sequence

TACATTAAAAAATTAAAAAATAGAGGGAATACTTATTTTGTTTCGTATTATAAGATGTTTCGGATTTTAAACATATTCATGTATGAATCCATGTATATAT[G/ATATG,ATG,A,ATATATG,ATATATATG]
TGTTTCATATATAAATATATGCATAATCATACAGATGTTAATGAGTTAGACTATAAATCAAGAGACCAAAACGTTTATAACGTAAGACATGGGAGTAGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CATAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.00% 29.10% 4.66% 0.00% T: 16.57%; CAT: 16.10%; CATATAT: 0.59%; CATATATAT: 0.02%
All Indica  2759 22.40% 48.70% 0.76% 0.00% CAT: 26.79%; CATATAT: 1.01%; T: 0.25%; CATATATAT: 0.04%
All Japonica  1512 39.00% 0.40% 12.30% 0.00% T: 47.95%; CAT: 0.33%
Aus  269 96.30% 2.20% 0.00% 0.00% CAT: 1.12%; T: 0.37%
Indica I  595 50.30% 43.00% 1.34% 0.00% CATATAT: 3.19%; CAT: 2.02%; CATATATAT: 0.17%
Indica II  465 14.20% 29.20% 0.65% 0.00% CAT: 55.48%; T: 0.43%
Indica III  913 2.60% 67.50% 0.22% 0.00% CAT: 29.35%; CATATAT: 0.22%; T: 0.11%
Indica Intermediate  786 29.30% 42.70% 1.02% 0.00% CAT: 25.57%; CATATAT: 0.89%; T: 0.51%
Temperate Japonica  767 59.70% 0.30% 22.29% 0.00% T: 17.60%; CAT: 0.13%
Tropical Japonica  504 9.70% 0.40% 1.19% 0.00% T: 88.29%; CAT: 0.40%
Japonica Intermediate  241 34.40% 0.80% 3.73% 0.00% T: 60.17%; CAT: 0.83%
VI/Aromatic  96 46.90% 2.10% 11.46% 0.00% T: 37.50%; CAT: 2.08%
Intermediate  90 51.10% 17.80% 2.22% 0.00% T: 15.56%; CAT: 13.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916568531 C -> CATATATAT LOC_Os09g27250.1 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CATATATAT LOC_Os09g27260.1 downstream_gene_variant ; 4968.0bp to feature; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CATATATAT LOC_Os09g27250-LOC_Os09g27260 intergenic_region ; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> T LOC_Os09g27250.1 upstream_gene_variant ; 2453.0bp to feature; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> T LOC_Os09g27260.1 downstream_gene_variant ; 4969.0bp to feature; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> T LOC_Os09g27250-LOC_Os09g27260 intergenic_region ; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CAT LOC_Os09g27250.1 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CAT LOC_Os09g27260.1 downstream_gene_variant ; 4968.0bp to feature; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CAT LOC_Os09g27250-LOC_Os09g27260 intergenic_region ; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CATAT LOC_Os09g27250.1 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CATAT LOC_Os09g27260.1 downstream_gene_variant ; 4968.0bp to feature; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CATAT LOC_Os09g27250-LOC_Os09g27260 intergenic_region ; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CATATAT LOC_Os09g27250.1 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CATATAT LOC_Os09g27260.1 downstream_gene_variant ; 4968.0bp to feature; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N
vg0916568531 C -> CATATAT LOC_Os09g27250-LOC_Os09g27260 intergenic_region ; MODIFIER silent_mutation Average:42.056; most accessible tissue: Callus, score: 73.69 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916568531 NA 6.19E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916568531 7.45E-07 NA mr1224_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916568531 NA 1.05E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916568531 NA 4.80E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916568531 NA 1.09E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916568531 NA 1.32E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916568531 NA 8.97E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916568531 NA 6.26E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916568531 NA 9.17E-08 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916568531 NA 2.77E-08 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916568531 NA 3.39E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251