\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916567594:

Variant ID: vg0916567594 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 16567594
Reference Allele: AGAlternative Allele: GG,A
Primary Allele: GGSecondary Allele: AG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATATAATTGATTTACTTTGCTGAATTTTTATAAAGAAATTCTATTTAATTAGGTGATATGTAACGAACAAGGGACAATTTTTCAAGAGAAAAAAAAAA[AG/GG,A]
AGTAAAGTCCATCACCGGTCCCTAAACTTGTACCGCTGTGTCATCCCGGTCCCTAAACTCACAAATCGACCGTTCAGGTCCTCAAACTTGTTCAACTGTG

Reverse complement sequence

CACAGTTGAACAAGTTTGAGGACCTGAACGGTCGATTTGTGAGTTTAGGGACCGGGATGACACAGCGGTACAAGTTTAGGGACCGGTGATGGACTTTACT[CT/CC,T]
TTTTTTTTTTCTCTTGAAAAATTGTCCCTTGTTCGTTACATATCACCTAATTAAATAGAATTTCTTTATAAAAATTCAGCAAAGTAAATCAATTATATCA

Allele Frequencies:

Populations Population SizeFrequency of GG(primary allele) Frequency of AG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 36.50% 4.57% 5.37% A: 7.68%
All Indica  2759 77.20% 2.40% 7.58% 9.17% A: 3.59%
All Japonica  1512 0.10% 99.50% 0.20% 0.00% A: 0.13%
Aus  269 3.30% 1.50% 0.00% 0.00% A: 95.17%
Indica I  595 50.40% 4.70% 17.31% 27.23% A: 0.34%
Indica II  465 84.90% 2.20% 3.66% 2.58% A: 6.67%
Indica III  913 97.50% 0.30% 0.44% 0.33% A: 1.42%
Indica Intermediate  786 69.50% 3.30% 10.81% 9.67% A: 6.74%
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 99.40% 0.20% 0.00% A: 0.40%
Japonica Intermediate  241 0.00% 99.20% 0.83% 0.00% NA
VI/Aromatic  96 3.10% 94.80% 1.04% 0.00% A: 1.04%
Intermediate  90 27.80% 62.20% 3.33% 1.11% A: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916567594 AG -> DEL N N silent_mutation Average:25.679; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0916567594 AG -> A LOC_Os09g27250.1 upstream_gene_variant ; 1517.0bp to feature; MODIFIER silent_mutation Average:25.679; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0916567594 AG -> A LOC_Os09g27250-LOC_Os09g27260 intergenic_region ; MODIFIER silent_mutation Average:25.679; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0916567594 AG -> GG LOC_Os09g27250.1 upstream_gene_variant ; 1516.0bp to feature; MODIFIER silent_mutation Average:25.679; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0916567594 AG -> GG LOC_Os09g27250-LOC_Os09g27260 intergenic_region ; MODIFIER silent_mutation Average:25.679; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916567594 NA 8.49E-06 mr1641 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916567594 NA 7.08E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251