Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0916567594:

Variant ID: vg0916567594 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 16567594
Reference Allele: AG	Alternative Allele: GG,A
Primary Allele: GG	Secondary Allele: AG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGATATAATTGATTTACTTTGCTGAATTTTTATAAAGAAATTCTATTTAATTAGGTGATATGTAACGAACAAGGGACAATTTTTCAAGAGAAAAAAAAAA[AG/GG,A]
AGTAAAGTCCATCACCGGTCCCTAAACTTGTACCGCTGTGTCATCCCGGTCCCTAAACTCACAAATCGACCGTTCAGGTCCTCAAACTTGTTCAACTGTG

Reverse complement sequence

CACAGTTGAACAAGTTTGAGGACCTGAACGGTCGATTTGTGAGTTTAGGGACCGGGATGACACAGCGGTACAAGTTTAGGGACCGGTGATGGACTTTACT[CT/CC,T]
TTTTTTTTTTCTCTTGAAAAATTGTCCCTTGTTCGTTACATATCACCTAATTAAATAGAATTTCTTTATAAAAATTCAGCAAAGTAAATCAATTATATCA

Allele Frequencies:

Populations	Population Size	Frequency of GG(primary allele)	Frequency of AG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.90%	36.50%	4.57%	5.37%	A: 7.68%
All Indica	2759	77.20%	2.40%	7.58%	9.17%	A: 3.59%
All Japonica	1512	0.10%	99.50%	0.20%	0.00%	A: 0.13%
Aus	269	3.30%	1.50%	0.00%	0.00%	A: 95.17%
Indica I	595	50.40%	4.70%	17.31%	27.23%	A: 0.34%
Indica II	465	84.90%	2.20%	3.66%	2.58%	A: 6.67%
Indica III	913	97.50%	0.30%	0.44%	0.33%	A: 1.42%
Indica Intermediate	786	69.50%	3.30%	10.81%	9.67%	A: 6.74%
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.00%	99.40%	0.20%	0.00%	A: 0.40%
Japonica Intermediate	241	0.00%	99.20%	0.83%	0.00%	NA
VI/Aromatic	96	3.10%	94.80%	1.04%	0.00%	A: 1.04%
Intermediate	90	27.80%	62.20%	3.33%	1.11%	A: 5.56%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916567594	AG -> DEL	N	N	silent_mutation	Average:25.679; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0916567594	AG -> A	LOC_Os09g27250.1	upstream_gene_variant ; 1517.0bp to feature; MODIFIER	silent_mutation	Average:25.679; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0916567594	AG -> A	LOC_Os09g27250-LOC_Os09g27260	intergenic_region ; MODIFIER	silent_mutation	Average:25.679; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0916567594	AG -> GG	LOC_Os09g27250.1	upstream_gene_variant ; 1516.0bp to feature; MODIFIER	silent_mutation	Average:25.679; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0916567594	AG -> GG	LOC_Os09g27250-LOC_Os09g27260	intergenic_region ; MODIFIER	silent_mutation	Average:25.679; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916567594	NA	8.49E-06	mr1641	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916567594	NA	7.08E-06	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251