\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916509097:

Variant ID: vg0916509097 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16509097
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAAGTATGATTCATGTCCTCCAACCATAAAAACCGGGTATATCGACTCCTCCAACCATCAAAACTGGTGCAAACAATGTTCCTTGGTAGTTTTGGCTAA[C/T]
ATGGCGTCTACATGGCGATCTTAGCCGAGTCTTTATCCTACGTGGCGCTTACGTGGCATTAGCTTGGACATAAGTTGGAGATGTGGATAACAAGTTTGAA

Reverse complement sequence

TTCAAACTTGTTATCCACATCTCCAACTTATGTCCAAGCTAATGCCACGTAAGCGCCACGTAGGATAAAGACTCGGCTAAGATCGCCATGTAGACGCCAT[G/A]
TTAGCCAAAACTACCAAGGAACATTGTTTGCACCAGTTTTGATGGTTGGAGGAGTCGATATACCCGGTTTTTATGGTTGGAGGACATGAATCATACTTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 41.00% 0.19% 0.00% NA
All Indica  2759 30.30% 69.50% 0.22% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 56.30% 43.40% 0.34% 0.00% NA
Indica II  465 15.30% 84.70% 0.00% 0.00% NA
Indica III  913 15.60% 84.30% 0.11% 0.00% NA
Indica Intermediate  786 36.50% 63.10% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916509097 C -> T LOC_Os09g27140.1 upstream_gene_variant ; 278.0bp to feature; MODIFIER silent_mutation Average:93.84; most accessible tissue: Minghui63 young leaf, score: 96.582 N N N N
vg0916509097 C -> T LOC_Os09g27140.2 upstream_gene_variant ; 278.0bp to feature; MODIFIER silent_mutation Average:93.84; most accessible tissue: Minghui63 young leaf, score: 96.582 N N N N
vg0916509097 C -> T LOC_Os09g27150.1 downstream_gene_variant ; 416.0bp to feature; MODIFIER silent_mutation Average:93.84; most accessible tissue: Minghui63 young leaf, score: 96.582 N N N N
vg0916509097 C -> T LOC_Os09g27140-LOC_Os09g27150 intergenic_region ; MODIFIER silent_mutation Average:93.84; most accessible tissue: Minghui63 young leaf, score: 96.582 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0916509097 C T -0.02 -0.02 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916509097 NA 1.90E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 8.96E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 1.74E-12 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 5.06E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 9.35E-10 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 9.84E-06 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 9.87E-07 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 3.76E-28 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 6.66E-08 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 7.46E-14 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 1.70E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 5.26E-20 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 1.04E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 1.55E-08 mr1536_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 2.58E-09 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916509097 NA 3.93E-07 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251