\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916496482:

Variant ID: vg0916496482 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16496482
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTTTTCGGTCGCCCTCTGGCGAATCCGAGCCGTAGGCTCATTTTTCCTCGCCCCGCTCGTCATTCAGGTGCGCTTCCCTCGTAGCGCCGTGCGCCGCTC[C/T]
GGTGAACGTCGCCGCCGCCCGCCGTCGGATCCACGGCAGGGTCGTCTTCCTCCTTGCACCGTCCCGCGTGGCTGCCACGTCCTCGGCTCTCCCCTCTCCC

Reverse complement sequence

GGGAGAGGGGAGAGCCGAGGACGTGGCAGCCACGCGGGACGGTGCAAGGAGGAAGACGACCCTGCCGTGGATCCGACGGCGGGCGGCGGCGACGTTCACC[G/A]
GAGCGGCGCACGGCGCTACGAGGGAAGCGCACCTGAATGACGAGCGGGGCGAGGAAAAATGAGCCTACGGCTCGGATTCGCCAGAGGGCGACCGAAAACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.50% 19.00% 0.49% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 43.90% 54.80% 1.32% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 67.80% 31.40% 0.78% 0.00% NA
Tropical Japonica  504 11.50% 85.90% 2.58% 0.00% NA
Japonica Intermediate  241 35.70% 63.90% 0.41% 0.00% NA
VI/Aromatic  96 53.10% 45.80% 1.04% 0.00% NA
Intermediate  90 78.90% 18.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916496482 C -> T LOC_Os09g27110.1 upstream_gene_variant ; 2598.0bp to feature; MODIFIER silent_mutation Average:97.855; most accessible tissue: Zhenshan97 panicle, score: 99.094 N N N N
vg0916496482 C -> T LOC_Os09g27120.1 upstream_gene_variant ; 37.0bp to feature; MODIFIER silent_mutation Average:97.855; most accessible tissue: Zhenshan97 panicle, score: 99.094 N N N N
vg0916496482 C -> T LOC_Os09g27130.1 downstream_gene_variant ; 1158.0bp to feature; MODIFIER silent_mutation Average:97.855; most accessible tissue: Zhenshan97 panicle, score: 99.094 N N N N
vg0916496482 C -> T LOC_Os09g27135.1 downstream_gene_variant ; 2734.0bp to feature; MODIFIER silent_mutation Average:97.855; most accessible tissue: Zhenshan97 panicle, score: 99.094 N N N N
vg0916496482 C -> T LOC_Os09g27120-LOC_Os09g27130 intergenic_region ; MODIFIER silent_mutation Average:97.855; most accessible tissue: Zhenshan97 panicle, score: 99.094 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0916496482 C T -0.09 -0.09 -0.08 -0.08 -0.08 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916496482 NA 4.66E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 4.70E-06 4.70E-06 mr1036_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 8.56E-06 NA mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 4.62E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 4.10E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 4.67E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 4.36E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 4.12E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 4.27E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 2.33E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 6.28E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 7.76E-08 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 2.30E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 2.02E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 1.30E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 6.18E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 2.88E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 8.57E-15 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 6.19E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916496482 NA 9.38E-07 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251