Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916476181:

Variant ID: vg0916476181 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 16476181
Reference Allele: CAAGACAAATGATCA	Alternative Allele: TAAGACAAATGATCA,C
Primary Allele: CAAGACAAATGATCA	Secondary Allele: TAAGACAAATGATCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAAGTAAGTATTTTTTTTTTCTTTTATAGCGGCTTGATTTGTCACTAATGGAACTTCAAGCAATACTTATATTTTGGGATTTCCATAAAATTTTTAAA[CAAGACAAATGATCA/TAAGACAAATGATCA,C]
AAGATTTTAACAAAAGTCAATAATGTCATAGAGATGGCATATAAGTATTTGTGGGTTGCTTAGACGGGCCCATTTGAGTTCACGTGAGATGAAATTTAAG

Reverse complement sequence

CTTAAATTTCATCTCACGTGAACTCAAATGGGCCCGTCTAAGCAACCCACAAATACTTATATGCCATCTCTATGACATTATTGACTTTTGTTAAAATCTT[TGATCATTTGTCTTG/TGATCATTTGTCTTA,G]
TTTAAAAATTTTATGGAAATCCCAAAATATAAGTATTGCTTGAAGTTCCATTAGTGACAAATCAAGCCGCTATAAAAGAAAAAAAAAATACTTACTTAAA

Allele Frequencies:

Populations	Population Size	Frequency of CAAGACAAATGATCA(primary allele)	Frequency of TAAGACAAATGATCA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.90%	19.70%	0.28%	0.00%	C: 0.08%
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	42.40%	56.70%	0.73%	0.00%	C: 0.13%
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	67.40%	32.20%	0.39%	0.00%	NA
Tropical Japonica	504	7.90%	91.10%	0.60%	0.00%	C: 0.40%
Japonica Intermediate	241	34.90%	63.10%	2.07%	0.00%	NA
VI/Aromatic	96	54.20%	45.80%	0.00%	0.00%	NA
Intermediate	90	72.20%	23.30%	2.22%	0.00%	C: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916476181	CAAGACAAATGATCA -> TAAGACAAATGATCA	LOC_Os09g27080.1	upstream_gene_variant ; 762.0bp to feature; MODIFIER	silent_mutation	Average:41.211; most accessible tissue: Callus, score: 71.118	N	N	N	N
vg0916476181	CAAGACAAATGATCA -> TAAGACAAATGATCA	LOC_Os09g27080.2	upstream_gene_variant ; 834.0bp to feature; MODIFIER	silent_mutation	Average:41.211; most accessible tissue: Callus, score: 71.118	N	N	N	N
vg0916476181	CAAGACAAATGATCA -> TAAGACAAATGATCA	LOC_Os09g27070.1	downstream_gene_variant ; 1595.0bp to feature; MODIFIER	silent_mutation	Average:41.211; most accessible tissue: Callus, score: 71.118	N	N	N	N
vg0916476181	CAAGACAAATGATCA -> TAAGACAAATGATCA	LOC_Os09g27070-LOC_Os09g27080	intergenic_region ; MODIFIER	silent_mutation	Average:41.211; most accessible tissue: Callus, score: 71.118	N	N	N	N
vg0916476181	CAAGACAAATGATCA -> C	LOC_Os09g27080.1	upstream_gene_variant ; 761.0bp to feature; MODIFIER	silent_mutation	Average:41.211; most accessible tissue: Callus, score: 71.118	N	N	N	N
vg0916476181	CAAGACAAATGATCA -> C	LOC_Os09g27080.2	upstream_gene_variant ; 833.0bp to feature; MODIFIER	silent_mutation	Average:41.211; most accessible tissue: Callus, score: 71.118	N	N	N	N
vg0916476181	CAAGACAAATGATCA -> C	LOC_Os09g27070.1	downstream_gene_variant ; 1596.0bp to feature; MODIFIER	silent_mutation	Average:41.211; most accessible tissue: Callus, score: 71.118	N	N	N	N
vg0916476181	CAAGACAAATGATCA -> C	LOC_Os09g27070-LOC_Os09g27080	intergenic_region ; MODIFIER	silent_mutation	Average:41.211; most accessible tissue: Callus, score: 71.118	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916476181	NA	1.04E-09	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	2.98E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	3.84E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	2.31E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	3.58E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	1.88E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	2.64E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	1.56E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	3.89E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	5.52E-06	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	5.38E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	1.16E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	6.78E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	3.81E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	4.19E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	7.89E-08	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	3.28E-08	mr1621_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	5.54E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	3.96E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	7.94E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	1.69E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	6.42E-14	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181	NA	2.17E-07	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251