\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916476181:

Variant ID: vg0916476181 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 16476181
Reference Allele: CAAGACAAATGATCAAlternative Allele: TAAGACAAATGATCA,C
Primary Allele: CAAGACAAATGATCASecondary Allele: TAAGACAAATGATCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAAGTAAGTATTTTTTTTTTCTTTTATAGCGGCTTGATTTGTCACTAATGGAACTTCAAGCAATACTTATATTTTGGGATTTCCATAAAATTTTTAAA[CAAGACAAATGATCA/TAAGACAAATGATCA,C]
AAGATTTTAACAAAAGTCAATAATGTCATAGAGATGGCATATAAGTATTTGTGGGTTGCTTAGACGGGCCCATTTGAGTTCACGTGAGATGAAATTTAAG

Reverse complement sequence

CTTAAATTTCATCTCACGTGAACTCAAATGGGCCCGTCTAAGCAACCCACAAATACTTATATGCCATCTCTATGACATTATTGACTTTTGTTAAAATCTT[TGATCATTTGTCTTG/TGATCATTTGTCTTA,G]
TTTAAAAATTTTATGGAAATCCCAAAATATAAGTATTGCTTGAAGTTCCATTAGTGACAAATCAAGCCGCTATAAAAGAAAAAAAAAATACTTACTTAAA

Allele Frequencies:

Populations Population SizeFrequency of CAAGACAAATGATCA(primary allele) Frequency of TAAGACAAATGATCA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.90% 19.70% 0.28% 0.00% C: 0.08%
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 42.40% 56.70% 0.73% 0.00% C: 0.13%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 67.40% 32.20% 0.39% 0.00% NA
Tropical Japonica  504 7.90% 91.10% 0.60% 0.00% C: 0.40%
Japonica Intermediate  241 34.90% 63.10% 2.07% 0.00% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 72.20% 23.30% 2.22% 0.00% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916476181 CAAGACAAATGATCA -> TAAGACAAATGATCA LOC_Os09g27080.1 upstream_gene_variant ; 762.0bp to feature; MODIFIER silent_mutation Average:41.211; most accessible tissue: Callus, score: 71.118 N N N N
vg0916476181 CAAGACAAATGATCA -> TAAGACAAATGATCA LOC_Os09g27080.2 upstream_gene_variant ; 834.0bp to feature; MODIFIER silent_mutation Average:41.211; most accessible tissue: Callus, score: 71.118 N N N N
vg0916476181 CAAGACAAATGATCA -> TAAGACAAATGATCA LOC_Os09g27070.1 downstream_gene_variant ; 1595.0bp to feature; MODIFIER silent_mutation Average:41.211; most accessible tissue: Callus, score: 71.118 N N N N
vg0916476181 CAAGACAAATGATCA -> TAAGACAAATGATCA LOC_Os09g27070-LOC_Os09g27080 intergenic_region ; MODIFIER silent_mutation Average:41.211; most accessible tissue: Callus, score: 71.118 N N N N
vg0916476181 CAAGACAAATGATCA -> C LOC_Os09g27080.1 upstream_gene_variant ; 761.0bp to feature; MODIFIER silent_mutation Average:41.211; most accessible tissue: Callus, score: 71.118 N N N N
vg0916476181 CAAGACAAATGATCA -> C LOC_Os09g27080.2 upstream_gene_variant ; 833.0bp to feature; MODIFIER silent_mutation Average:41.211; most accessible tissue: Callus, score: 71.118 N N N N
vg0916476181 CAAGACAAATGATCA -> C LOC_Os09g27070.1 downstream_gene_variant ; 1596.0bp to feature; MODIFIER silent_mutation Average:41.211; most accessible tissue: Callus, score: 71.118 N N N N
vg0916476181 CAAGACAAATGATCA -> C LOC_Os09g27070-LOC_Os09g27080 intergenic_region ; MODIFIER silent_mutation Average:41.211; most accessible tissue: Callus, score: 71.118 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916476181 NA 1.04E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 2.98E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 3.84E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 2.31E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 3.58E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 1.88E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 2.64E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 1.56E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 3.89E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 5.52E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 5.38E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 1.16E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 6.78E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 3.81E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 4.19E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 7.89E-08 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 3.28E-08 mr1621_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 5.54E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 3.96E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 7.94E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 1.69E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 6.42E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916476181 NA 2.17E-07 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251