\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916428615:

Variant ID: vg0916428615 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16428615
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATTGATGAATACGCTTATTTTTATAGCTATTTGAAACTATAAACAGATGAATTAACTAGTAATATGTTGAACAGTTGCTTTAGAAAAAATATTTTAT[A/T]
AAACGTATTATTTAGGAGCTTGGGAAGTGTGAAAAAGAATCTAACATCTAGAATCACTGTTCAGTTGTTCATGGACCTTAAATCCAATATTTTTTTTATT

Reverse complement sequence

AATAAAAAAAATATTGGATTTAAGGTCCATGAACAACTGAACAGTGATTCTAGATGTTAGATTCTTTTTCACACTTCCCAAGCTCCTAAATAATACGTTT[T/A]
ATAAAATATTTTTTCTAAAGCAACTGTTCAACATATTACTAGTTAATTCATCTGTTTATAGTTTCAAATAGCTATAAAAATAAGCGTATTCATCAATTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.70% 20.30% 0.04% 0.00% NA
All Indica  2759 75.30% 24.60% 0.07% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 59.30% 40.50% 0.17% 0.00% NA
Indica II  465 87.70% 12.30% 0.00% 0.00% NA
Indica III  913 79.10% 20.90% 0.00% 0.00% NA
Indica Intermediate  786 75.70% 24.20% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916428615 A -> T LOC_Os09g27010.1 upstream_gene_variant ; 3397.0bp to feature; MODIFIER silent_mutation Average:67.397; most accessible tissue: Minghui63 root, score: 85.142 N N N N
vg0916428615 A -> T LOC_Os09g27010-LOC_Os09g27020 intergenic_region ; MODIFIER silent_mutation Average:67.397; most accessible tissue: Minghui63 root, score: 85.142 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916428615 NA 4.73E-08 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 3.37E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 2.37E-10 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 4.07E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 1.38E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 5.55E-10 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 7.82E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 4.02E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 1.58E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 5.06E-06 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 1.70E-10 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 9.24E-09 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 6.80E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 1.48E-10 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 1.57E-09 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 8.55E-06 8.55E-06 mr1821_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 NA 1.84E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916428615 2.41E-06 NA mr1928_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251