\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916342758:

Variant ID: vg0916342758 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16342758
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCCCTAGGAGGAGAGGAGACACGGACAATCAACGGGCAACATAGACGCCACAAAGCCATGAACCAATACAAGCCAACATACGCCAAGACAAGACGCCA[G/T]
ATATCGATTTCGGAGATAAGCACGACTAGTCCCCTACGGTATCTCCGGATACTGTCAGGAGAGACGAAAGCGTTATCTTTGATCTCGCCGAGCACGAACT

Reverse complement sequence

AGTTCGTGCTCGGCGAGATCAAAGATAACGCTTTCGTCTCTCCTGACAGTATCCGGAGATACCGTAGGGGACTAGTCGTGCTTATCTCCGAAATCGATAT[C/A]
TGGCGTCTTGTCTTGGCGTATGTTGGCTTGTATTGGTTCATGGCTTTGTGGCGTCTATGTTGCCCGTTGATTGTCCGTGTCTCCTCTCCTCCTAGGGGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.20% 0.30% 0.06% NA
All Indica  2759 43.30% 56.10% 0.47% 0.11% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 84.40% 15.60% 0.00% 0.00% NA
Indica I  595 63.40% 36.30% 0.34% 0.00% NA
Indica II  465 21.70% 78.10% 0.22% 0.00% NA
Indica III  913 37.10% 62.30% 0.44% 0.11% NA
Indica Intermediate  786 48.10% 50.90% 0.76% 0.25% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916342758 G -> DEL N N silent_mutation Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0916342758 G -> T LOC_Os09g26880.1 upstream_gene_variant ; 4117.0bp to feature; MODIFIER silent_mutation Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0916342758 G -> T LOC_Os09g26890.1 upstream_gene_variant ; 1040.0bp to feature; MODIFIER silent_mutation Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0916342758 G -> T LOC_Os09g26900.1 upstream_gene_variant ; 4322.0bp to feature; MODIFIER silent_mutation Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0916342758 G -> T LOC_Os09g26880.3 upstream_gene_variant ; 4120.0bp to feature; MODIFIER silent_mutation Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0916342758 G -> T LOC_Os09g26880.4 upstream_gene_variant ; 4120.0bp to feature; MODIFIER silent_mutation Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0916342758 G -> T LOC_Os09g26880-LOC_Os09g26890 intergenic_region ; MODIFIER silent_mutation Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916342758 NA 1.02E-18 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0916342758 NA 1.40E-18 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0916342758 NA 2.50E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 8.94E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 4.49E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 6.79E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 1.81E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 3.69E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 2.08E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 5.26E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 2.22E-19 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 3.02E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 7.48E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 2.87E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 6.09E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 3.85E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 7.29E-11 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 2.46E-14 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 4.51E-09 mr1636_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 1.57E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 7.87E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 8.79E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 6.14E-07 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 7.12E-07 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 1.03E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758 NA 6.74E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251