Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916342758:

Variant ID: vg0916342758 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16342758
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

ACCCCCTAGGAGGAGAGGAGACACGGACAATCAACGGGCAACATAGACGCCACAAAGCCATGAACCAATACAAGCCAACATACGCCAAGACAAGACGCCA[G/T]
ATATCGATTTCGGAGATAAGCACGACTAGTCCCCTACGGTATCTCCGGATACTGTCAGGAGAGACGAAAGCGTTATCTTTGATCTCGCCGAGCACGAACT

Reverse complement sequence

AGTTCGTGCTCGGCGAGATCAAAGATAACGCTTTCGTCTCTCCTGACAGTATCCGGAGATACCGTAGGGGACTAGTCGTGCTTATCTCCGAAATCGATAT[C/A]
TGGCGTCTTGTCTTGGCGTATGTTGGCTTGTATTGGTTCATGGCTTTGTGGCGTCTATGTTGCCCGTTGATTGTCCGTGTCTCCTCTCCTCCTAGGGGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.40%	34.20%	0.30%	0.06%	NA
All Indica	2759	43.30%	56.10%	0.47%	0.11%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	84.40%	15.60%	0.00%	0.00%	NA
Indica I	595	63.40%	36.30%	0.34%	0.00%	NA
Indica II	465	21.70%	78.10%	0.22%	0.00%	NA
Indica III	913	37.10%	62.30%	0.44%	0.11%	NA
Indica Intermediate	786	48.10%	50.90%	0.76%	0.25%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916342758	G -> DEL	N	N	silent_mutation	Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0916342758	G -> T	LOC_Os09g26880.1	upstream_gene_variant ; 4117.0bp to feature; MODIFIER	silent_mutation	Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0916342758	G -> T	LOC_Os09g26890.1	upstream_gene_variant ; 1040.0bp to feature; MODIFIER	silent_mutation	Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0916342758	G -> T	LOC_Os09g26900.1	upstream_gene_variant ; 4322.0bp to feature; MODIFIER	silent_mutation	Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0916342758	G -> T	LOC_Os09g26880.3	upstream_gene_variant ; 4120.0bp to feature; MODIFIER	silent_mutation	Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0916342758	G -> T	LOC_Os09g26880.4	upstream_gene_variant ; 4120.0bp to feature; MODIFIER	silent_mutation	Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0916342758	G -> T	LOC_Os09g26880-LOC_Os09g26890	intergenic_region ; MODIFIER	silent_mutation	Average:65.219; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916342758	NA	1.02E-18	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0916342758	NA	1.40E-18	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0916342758	NA	2.50E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	8.94E-06	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	4.49E-13	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	6.79E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	1.81E-06	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	3.69E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	2.08E-20	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	5.26E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	2.22E-19	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	3.02E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	7.48E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	2.87E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	6.09E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	3.85E-21	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	7.29E-11	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	2.46E-14	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	4.51E-09	mr1636_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	1.57E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	7.87E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	8.79E-06	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	6.14E-07	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	7.12E-07	mr1882_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	1.03E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916342758	NA	6.74E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251