\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916326182:

Variant ID: vg0916326182 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16326182
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAGCACCACCGGATCCGACGACCCCCTCCTCCCCTTTCTCCCCTCCTCACGAAACCGCCTCGCCTTCCTCTTCTTTTCTTTTTCGCTCGCTTCGCATC[G/T]
CTCACATGCCCCTGCCTGCCGCCGCAGACGGGGCGCCATGTCGCGTAGCGGGGTGGAGGTGGTCGTGAGCAGGGGTTGCTCCAGGCTCGTCCTCCCCGGG

Reverse complement sequence

CCCGGGGAGGACGAGCCTGGAGCAACCCCTGCTCACGACCACCTCCACCCCGCTACGCGACATGGCGCCCCGTCTGCGGCGGCAGGCAGGGGCATGTGAG[C/A]
GATGCGAAGCGAGCGAAAAAGAAAAGAAGAGGAAGGCGAGGCGGTTTCGTGAGGAGGGGAGAAAGGGGAGGAGGGGGTCGTCGGATCCGGTGGTGCTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 30.40% 0.04% 0.25% NA
All Indica  2759 56.20% 43.30% 0.07% 0.43% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 16.70% 83.30% 0.00% 0.00% NA
Indica I  595 38.30% 61.30% 0.17% 0.17% NA
Indica II  465 77.00% 22.60% 0.00% 0.43% NA
Indica III  913 63.10% 36.40% 0.00% 0.55% NA
Indica Intermediate  786 49.40% 50.00% 0.13% 0.51% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916326182 G -> DEL N N silent_mutation Average:95.575; most accessible tissue: Zhenshan97 flower, score: 97.212 N N N N
vg0916326182 G -> T LOC_Os09g26870.1 5_prime_UTR_variant ; 38.0bp to feature; MODIFIER silent_mutation Average:95.575; most accessible tissue: Zhenshan97 flower, score: 97.212 N N N N
vg0916326182 G -> T LOC_Os09g26860.1 upstream_gene_variant ; 2664.0bp to feature; MODIFIER silent_mutation Average:95.575; most accessible tissue: Zhenshan97 flower, score: 97.212 N N N N
vg0916326182 G -> T LOC_Os09g26880.1 downstream_gene_variant ; 3906.0bp to feature; MODIFIER silent_mutation Average:95.575; most accessible tissue: Zhenshan97 flower, score: 97.212 N N N N
vg0916326182 G -> T LOC_Os09g26880.3 downstream_gene_variant ; 3906.0bp to feature; MODIFIER silent_mutation Average:95.575; most accessible tissue: Zhenshan97 flower, score: 97.212 N N N N
vg0916326182 G -> T LOC_Os09g26880.4 downstream_gene_variant ; 3906.0bp to feature; MODIFIER silent_mutation Average:95.575; most accessible tissue: Zhenshan97 flower, score: 97.212 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0916326182 G T -0.01 -0.01 -0.01 0.0 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916326182 NA 1.07E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0916326182 NA 1.24E-08 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 2.18E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 9.68E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 5.74E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 2.29E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 1.95E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 4.00E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 6.19E-08 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 4.00E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 4.56E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 1.07E-10 mr1895_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916326182 NA 7.35E-08 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251