\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916259464:

Variant ID: vg0916259464 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16259464
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAACAATAGTAAGGCTCCGTTCGGTAGTACAAGTTCCCAACTCCTCCTCCTCATTTTCTGCGCGCACGCTTTACAAACTGTTAAACGGTGCGTTTTCTG[T/C]
AAAAAGTTTCTATACGAAAGTTGCTTAAAAAAATCATACCAATCTATTTTTGAAAAAAATATCTAAAACTTAATTAATCACGTATTAAAACGCTGCTTCG

Reverse complement sequence

CGAAGCAGCGTTTTAATACGTGATTAATTAAGTTTTAGATATTTTTTTCAAAAATAGATTGGTATGATTTTTTTAAGCAACTTTCGTATAGAAACTTTTT[A/G]
CAGAAAACGCACCGTTTAACAGTTTGTAAAGCGTGCGCGCAGAAAATGAGGAGGAGGAGTTGGGAACTTGTACTACCGAACGGAGCCTTACTATTGTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 42.60% 0.11% 0.00% NA
All Indica  2759 86.60% 13.30% 0.11% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 62.50% 37.30% 0.17% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 97.70% 2.20% 0.11% 0.00% NA
Indica Intermediate  786 86.30% 13.60% 0.13% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.00% 0.20% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 37.80% 61.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916259464 T -> C LOC_Os09g26760.1 upstream_gene_variant ; 1906.0bp to feature; MODIFIER silent_mutation Average:70.238; most accessible tissue: Callus, score: 95.38 N N N N
vg0916259464 T -> C LOC_Os09g26770.2 upstream_gene_variant ; 2274.0bp to feature; MODIFIER silent_mutation Average:70.238; most accessible tissue: Callus, score: 95.38 N N N N
vg0916259464 T -> C LOC_Os09g26770.3 upstream_gene_variant ; 214.0bp to feature; MODIFIER silent_mutation Average:70.238; most accessible tissue: Callus, score: 95.38 N N N N
vg0916259464 T -> C LOC_Os09g26760-LOC_Os09g26770 intergenic_region ; MODIFIER silent_mutation Average:70.238; most accessible tissue: Callus, score: 95.38 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916259464 6.19E-06 2.76E-10 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 1.87E-08 NA mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 1.95E-07 7.35E-13 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 2.83E-09 NA mr1728 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 1.81E-08 2.04E-16 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 3.52E-06 1.13E-11 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 NA 2.60E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 1.09E-06 1.11E-11 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 5.93E-07 5.65E-10 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 2.39E-07 NA mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 1.05E-06 5.97E-10 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 5.60E-09 NA mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 9.83E-09 4.89E-16 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 8.39E-06 NA mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916259464 8.68E-07 1.09E-12 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251