| Variant ID: vg0916244059 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 16244059 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, G: 0.23, others allele: 0.00, population size: 101. )
TACTCTGGCCAGAGGTGTACAACTGTACCCACAAGACACGATTCCACACATGTCGCCATGCCCCGAAGTATCACCATGATACTGCAAAGGGGGAAATCGT[A/G]
ACAAGACCCTCCACATAACCCTCCCCTAACCATCCACACCACGCTAAGGTTGCACCCTACCCCTCAAAAGGCAGTGGGCGGTCCCCTCTTGCGCCACGGT
ACCGTGGCGCAAGAGGGGACCGCCCACTGCCTTTTGAGGGGTAGGGTGCAACCTTAGCGTGGTGTGGATGGTTAGGGGAGGGTTATGTGGAGGGTCTTGT[T/C]
ACGATTTCCCCCTTTGCAGTATCATGGTGATACTTCGGGGCATGGCGACATGTGTGGAATCGTGTCTTGTGGGTACAGTTGTACACCTCTGGCCAGAGTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.10% | 36.10% | 25.31% | 1.46% | NA |
| All Indica | 2759 | 3.70% | 52.40% | 41.43% | 2.46% | NA |
| All Japonica | 1512 | 99.40% | 0.30% | 0.33% | 0.00% | NA |
| Aus | 269 | 1.50% | 87.70% | 10.78% | 0.00% | NA |
| Indica I | 595 | 2.00% | 83.00% | 12.77% | 2.18% | NA |
| Indica II | 465 | 3.40% | 25.60% | 63.87% | 7.10% | NA |
| Indica III | 913 | 2.20% | 46.80% | 50.82% | 0.22% | NA |
| Indica Intermediate | 786 | 6.90% | 51.70% | 38.93% | 2.54% | NA |
| Temperate Japonica | 767 | 99.50% | 0.10% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 16.70% | 20.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916244059 | A -> G | LOC_Os09g26730.1 | upstream_gene_variant ; 3266.0bp to feature; MODIFIER | silent_mutation | Average:23.969; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0916244059 | A -> G | LOC_Os09g26740.1 | upstream_gene_variant ; 1731.0bp to feature; MODIFIER | silent_mutation | Average:23.969; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0916244059 | A -> G | LOC_Os09g26750.1 | downstream_gene_variant ; 2540.0bp to feature; MODIFIER | silent_mutation | Average:23.969; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0916244059 | A -> G | LOC_Os09g26730-LOC_Os09g26740 | intergenic_region ; MODIFIER | silent_mutation | Average:23.969; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0916244059 | A -> DEL | N | N | silent_mutation | Average:23.969; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916244059 | NA | 6.81E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916244059 | NA | 8.37E-14 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916244059 | NA | 2.13E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916244059 | 3.33E-06 | 3.33E-06 | mr1455 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916244059 | NA | 4.91E-06 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916244059 | NA | 8.54E-08 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916244059 | NA | 5.72E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916244059 | NA | 1.20E-08 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916244059 | NA | 1.25E-06 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916244059 | NA | 1.34E-07 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916244059 | NA | 1.05E-14 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |