Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916242817:

Variant ID: vg0916242817 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16242817
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.43, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTGGGCGTCTACGACTTCACCGCCGGCCTGCCTCCGTCGCCGCCGACTGGTGTCCTCGCCTATACGGTTGGTTGGTCATACCACCGTTCATGGGCGTC[T/C]
ACATCTTCACCGACCGGCTGGCCTTCGCCGCCGTCGACTGGTGTTTCCGCCTGCACGGCTGGCCTATTATGCCAGCGTTGTTGGGCGTCTACGACTTCAC

Reverse complement sequence

GTGAAGTCGTAGACGCCCAACAACGCTGGCATAATAGGCCAGCCGTGCAGGCGGAAACACCAGTCGACGGCGGCGAAGGCCAGCCGGTCGGTGAAGATGT[A/G]
GACGCCCATGAACGGTGGTATGACCAACCAACCGTATAGGCGAGGACACCAGTCGGCGGCGACGGAGGCAGGCCGGCGGTGAAGTCGTAGACGCCCAACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.20%	6.80%	4.76%	50.30%	NA
All Indica	2759	5.60%	3.30%	7.79%	83.29%	NA
All Japonica	1512	99.30%	0.10%	0.20%	0.33%	NA
Aus	269	0.70%	81.40%	1.12%	16.73%	NA
Indica I	595	5.20%	3.20%	15.46%	76.13%	NA
Indica II	465	3.40%	2.60%	6.24%	87.74%	NA
Indica III	913	4.10%	2.10%	3.40%	90.47%	NA
Indica Intermediate	786	8.90%	5.30%	8.02%	77.74%	NA
Temperate Japonica	767	99.50%	0.00%	0.13%	0.39%	NA
Tropical Japonica	504	99.00%	0.40%	0.40%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	93.80%	2.10%	0.00%	4.17%	NA
Intermediate	90	61.10%	6.70%	4.44%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916242817	T -> DEL	N	N	silent_mutation	Average:35.386; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0916242817	T -> C	LOC_Os09g26730.1	upstream_gene_variant ; 2024.0bp to feature; MODIFIER	silent_mutation	Average:35.386; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0916242817	T -> C	LOC_Os09g26740.1	upstream_gene_variant ; 2973.0bp to feature; MODIFIER	silent_mutation	Average:35.386; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0916242817	T -> C	LOC_Os09g26750.1	downstream_gene_variant ; 3782.0bp to feature; MODIFIER	silent_mutation	Average:35.386; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0916242817	T -> C	LOC_Os09g26730-LOC_Os09g26740	intergenic_region ; MODIFIER	silent_mutation	Average:35.386; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916242817	NA	5.00E-08	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	8.05E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	2.27E-07	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	5.81E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	1.90E-06	mr1444	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	1.07E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	2.86E-08	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	8.76E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	1.94E-07	NA	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	6.25E-11	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	2.95E-08	1.26E-11	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	4.07E-06	7.85E-13	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	2.48E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	1.67E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	4.16E-06	NA	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	3.91E-07	2.13E-12	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	6.24E-10	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	1.60E-06	1.60E-06	mr1978	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	3.08E-08	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	1.08E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	2.25E-09	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	6.32E-07	NA	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	5.00E-06	2.06E-15	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	1.40E-06	NA	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	3.00E-07	8.99E-15	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	4.44E-06	NA	mr1931_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242817	NA	8.39E-07	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251