\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916242445:

Variant ID: vg0916242445 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16242445
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGGCACTACTGTTGCCAACTGGTGTCTTCGTCCCCACGGCTGGCATGGTATGCCGTTGCTGACGGTCGTCTTGATCTTCACCGACCGGCAGCCTCGTCG[C/T]
CGCCGACTGGTTTTCCTCACTTTCACGGTTGGATGGTCACACCACCGTTGTTGGTCATGCAAGCCTCTTCATCAAGCACAAATCAAACCATGTGTTTGGA

Reverse complement sequence

TCCAAACACATGGTTTGATTTGTGCTTGATGAAGAGGCTTGCATGACCAACAACGGTGGTGTGACCATCCAACCGTGAAAGTGAGGAAAACCAGTCGGCG[G/A]
CGACGAGGCTGCCGGTCGGTGAAGATCAAGACGACCGTCAGCAACGGCATACCATGCCAGCCGTGGGGACGAAGACACCAGTTGGCAACAGTAGTGCCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.00% 6.60% 3.91% 43.55% NA
All Indica  2759 10.40% 11.10% 6.38% 72.13% NA
All Japonica  1512 99.70% 0.00% 0.13% 0.20% NA
Aus  269 82.50% 0.00% 1.49% 15.99% NA
Indica I  595 6.90% 35.80% 4.54% 52.77% NA
Indica II  465 10.30% 2.20% 6.88% 80.65% NA
Indica III  913 7.70% 1.10% 6.68% 84.56% NA
Indica Intermediate  786 16.20% 9.40% 7.12% 67.30% NA
Temperate Japonica  767 99.60% 0.00% 0.26% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 3.30% 3.33% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916242445 C -> DEL N N silent_mutation Average:28.336; most accessible tissue: Callus, score: 70.891 N N N N
vg0916242445 C -> T LOC_Os09g26730.1 upstream_gene_variant ; 1652.0bp to feature; MODIFIER silent_mutation Average:28.336; most accessible tissue: Callus, score: 70.891 N N N N
vg0916242445 C -> T LOC_Os09g26740.1 upstream_gene_variant ; 3345.0bp to feature; MODIFIER silent_mutation Average:28.336; most accessible tissue: Callus, score: 70.891 N N N N
vg0916242445 C -> T LOC_Os09g26750.1 downstream_gene_variant ; 4154.0bp to feature; MODIFIER silent_mutation Average:28.336; most accessible tissue: Callus, score: 70.891 N N N N
vg0916242445 C -> T LOC_Os09g26730-LOC_Os09g26740 intergenic_region ; MODIFIER silent_mutation Average:28.336; most accessible tissue: Callus, score: 70.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916242445 2.89E-06 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 7.41E-06 5.06E-11 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 6.50E-06 6.49E-06 mr1276 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 1.49E-11 7.37E-25 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 2.70E-09 1.23E-16 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 3.54E-13 2.36E-29 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 6.66E-11 1.44E-20 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 4.40E-12 7.77E-23 mr1860 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 5.16E-11 8.14E-17 mr1860 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 1.55E-07 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 2.45E-06 7.29E-11 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 NA 4.26E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 1.08E-07 2.05E-19 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 4.52E-06 3.26E-12 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 9.82E-09 2.56E-30 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 2.04E-06 4.04E-18 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 3.53E-08 1.09E-21 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 8.50E-08 7.74E-16 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 NA 7.35E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916242445 NA 6.85E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251