\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916241458:

Variant ID: vg0916241458 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16241458
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGACAACTAGATCTCGTCAGATCTATAATACCCCCTGCGGATTAAAATCCCCAAACAGAAGTAGCGTATTACCTCTCATCGAGAGAGAGGGCCTGAACAT[G/A]
TCTAAATCCTTTGTCTCCGCATCCATCCACTTTTAGGTCTCGTCCGCTACCCCTTTTATTATTGCCGAATTCATGTTTCGACAGTTGGCGCGCCAGGTAG

Reverse complement sequence

CTACCTGGCGCGCCAACTGTCGAAACATGAATTCGGCAATAATAAAAGGGGTAGCGGACGAGACCTAAAAGTGGATGGATGCGGAGACAAAGGATTTAGA[C/T]
ATGTTCAGGCCCTCTCTCTCGATGAGAGGTAATACGCTACTTCTGTTTGGGGATTTTAATCCGCAGGGGGTATTATAGATCTGACGAGATCTAGTTGTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 5.40% 13.73% 27.44% NA
All Indica  2759 23.20% 9.10% 22.87% 44.91% NA
All Japonica  1512 99.60% 0.00% 0.20% 0.20% NA
Aus  269 83.60% 0.00% 3.35% 13.01% NA
Indica I  595 23.50% 28.60% 23.19% 24.71% NA
Indica II  465 18.90% 2.20% 16.99% 61.94% NA
Indica III  913 21.50% 1.00% 24.75% 52.79% NA
Indica Intermediate  786 27.40% 7.80% 23.92% 40.97% NA
Temperate Japonica  767 99.50% 0.00% 0.26% 0.26% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 70.00% 3.30% 5.56% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916241458 G -> DEL N N silent_mutation Average:31.689; most accessible tissue: Callus, score: 72.434 N N N N
vg0916241458 G -> A LOC_Os09g26730.1 upstream_gene_variant ; 665.0bp to feature; MODIFIER silent_mutation Average:31.689; most accessible tissue: Callus, score: 72.434 N N N N
vg0916241458 G -> A LOC_Os09g26740.1 upstream_gene_variant ; 4332.0bp to feature; MODIFIER silent_mutation Average:31.689; most accessible tissue: Callus, score: 72.434 N N N N
vg0916241458 G -> A LOC_Os09g26730-LOC_Os09g26740 intergenic_region ; MODIFIER silent_mutation Average:31.689; most accessible tissue: Callus, score: 72.434 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916241458 1.24E-06 1.24E-06 mr1276 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 1.48E-14 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 3.17E-09 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 2.20E-13 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 2.54E-09 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 1.17E-12 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 3.41E-09 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 2.92E-06 mr1136_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 1.98E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 2.26E-13 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 2.98E-08 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 2.62E-18 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 3.48E-11 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 1.96E-14 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916241458 NA 1.41E-10 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251