\
| Variant ID: vg0916241458 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 16241458 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGACAACTAGATCTCGTCAGATCTATAATACCCCCTGCGGATTAAAATCCCCAAACAGAAGTAGCGTATTACCTCTCATCGAGAGAGAGGGCCTGAACAT[G/A]
TCTAAATCCTTTGTCTCCGCATCCATCCACTTTTAGGTCTCGTCCGCTACCCCTTTTATTATTGCCGAATTCATGTTTCGACAGTTGGCGCGCCAGGTAG
CTACCTGGCGCGCCAACTGTCGAAACATGAATTCGGCAATAATAAAAGGGGTAGCGGACGAGACCTAAAAGTGGATGGATGCGGAGACAAAGGATTTAGA[C/T]
ATGTTCAGGCCCTCTCTCTCGATGAGAGGTAATACGCTACTTCTGTTTGGGGATTTTAATCCGCAGGGGGTATTATAGATCTGACGAGATCTAGTTGTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 5.40% | 13.73% | 27.44% | NA |
| All Indica | 2759 | 23.20% | 9.10% | 22.87% | 44.91% | NA |
| All Japonica | 1512 | 99.60% | 0.00% | 0.20% | 0.20% | NA |
| Aus | 269 | 83.60% | 0.00% | 3.35% | 13.01% | NA |
| Indica I | 595 | 23.50% | 28.60% | 23.19% | 24.71% | NA |
| Indica II | 465 | 18.90% | 2.20% | 16.99% | 61.94% | NA |
| Indica III | 913 | 21.50% | 1.00% | 24.75% | 52.79% | NA |
| Indica Intermediate | 786 | 27.40% | 7.80% | 23.92% | 40.97% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 70.00% | 3.30% | 5.56% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916241458 | G -> DEL | N | N | silent_mutation | Average:31.689; most accessible tissue: Callus, score: 72.434 | N | N | N | N |
| vg0916241458 | G -> A | LOC_Os09g26730.1 | upstream_gene_variant ; 665.0bp to feature; MODIFIER | silent_mutation | Average:31.689; most accessible tissue: Callus, score: 72.434 | N | N | N | N |
| vg0916241458 | G -> A | LOC_Os09g26740.1 | upstream_gene_variant ; 4332.0bp to feature; MODIFIER | silent_mutation | Average:31.689; most accessible tissue: Callus, score: 72.434 | N | N | N | N |
| vg0916241458 | G -> A | LOC_Os09g26730-LOC_Os09g26740 | intergenic_region ; MODIFIER | silent_mutation | Average:31.689; most accessible tissue: Callus, score: 72.434 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916241458 | 1.24E-06 | 1.24E-06 | mr1276 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 1.48E-14 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 3.17E-09 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 2.20E-13 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 2.54E-09 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 1.17E-12 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 3.41E-09 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 2.92E-06 | mr1136_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 1.98E-06 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 2.26E-13 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 2.98E-08 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 2.62E-18 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 3.48E-11 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 1.96E-14 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916241458 | NA | 1.41E-10 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |