Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916234298:

Variant ID: vg0916234298 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16234298
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

TGAAAAAGCTCCGAACATGAAGTTAGTGCTTCTAGCTTTCGAGCAGTTGTCGGGTCTTAAGATCAATTTTCATAAAAGTGAACTGTATTGTTTTGGTGAA[G/C]
TACTTGATTATAGTGATCAATACAACCAGCTCTTTGGCTGCCAGGTCGGCAACTTCCCATTCCGTTATCTGGGCATTCCGATCCATTATAGGAAGTTGAG

Reverse complement sequence

CTCAACTTCCTATAATGGATCGGAATGCCCAGATAACGGAATGGGAAGTTGCCGACCTGGCAGCCAAAGAGCTGGTTGTATTGATCACTATAATCAAGTA[C/G]
TTCACCAAAACAATACAGTTCACTTTTATGAAAATTGATCTTAAGACCCGACAACTGCTCGAAAGCTAGAAGCACTAACTTCATGTTCGGAGCTTTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	6.50%	0.00%	0.00%	NA
All Indica	2759	88.90%	11.10%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	64.20%	35.80%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	90.60%	9.40%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916234298	G -> C	LOC_Os09g26710.1	upstream_gene_variant ; 3233.0bp to feature; MODIFIER	silent_mutation	Average:28.645; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0916234298	G -> C	LOC_Os09g26700.1	downstream_gene_variant ; 4790.0bp to feature; MODIFIER	silent_mutation	Average:28.645; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0916234298	G -> C	LOC_Os09g26720.1	downstream_gene_variant ; 407.0bp to feature; MODIFIER	silent_mutation	Average:28.645; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0916234298	G -> C	LOC_Os09g26730.1	downstream_gene_variant ; 2140.0bp to feature; MODIFIER	silent_mutation	Average:28.645; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0916234298	G -> C	LOC_Os09g26720-LOC_Os09g26730	intergenic_region ; MODIFIER	silent_mutation	Average:28.645; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916234298	1.56E-06	NA	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	7.64E-06	5.88E-11	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	8.66E-06	8.66E-06	mr1276	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	NA	2.32E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	1.10E-10	9.79E-24	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	3.06E-08	2.21E-15	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	2.07E-10	5.66E-25	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	1.49E-08	1.52E-17	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	1.10E-10	1.13E-21	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	4.84E-10	2.16E-16	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	1.74E-11	NA	mr1138_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	4.22E-10	1.81E-13	mr1138_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	2.56E-07	2.24E-08	mr1354_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	3.40E-15	2.99E-26	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	1.08E-11	7.27E-17	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	3.88E-17	2.76E-35	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	2.42E-13	1.15E-22	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	2.44E-14	1.29E-26	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	4.88E-13	1.64E-20	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	NA	9.73E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298	NA	9.90E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251