\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916234298:

Variant ID: vg0916234298 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16234298
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAAAAGCTCCGAACATGAAGTTAGTGCTTCTAGCTTTCGAGCAGTTGTCGGGTCTTAAGATCAATTTTCATAAAAGTGAACTGTATTGTTTTGGTGAA[G/C]
TACTTGATTATAGTGATCAATACAACCAGCTCTTTGGCTGCCAGGTCGGCAACTTCCCATTCCGTTATCTGGGCATTCCGATCCATTATAGGAAGTTGAG

Reverse complement sequence

CTCAACTTCCTATAATGGATCGGAATGCCCAGATAACGGAATGGGAAGTTGCCGACCTGGCAGCCAAAGAGCTGGTTGTATTGATCACTATAATCAAGTA[C/G]
TTCACCAAAACAATACAGTTCACTTTTATGAAAATTGATCTTAAGACCCGACAACTGCTCGAAAGCTAGAAGCACTAACTTCATGTTCGGAGCTTTTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 6.50% 0.00% 0.00% NA
All Indica  2759 88.90% 11.10% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 64.20% 35.80% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 90.60% 9.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916234298 G -> C LOC_Os09g26710.1 upstream_gene_variant ; 3233.0bp to feature; MODIFIER silent_mutation Average:28.645; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0916234298 G -> C LOC_Os09g26700.1 downstream_gene_variant ; 4790.0bp to feature; MODIFIER silent_mutation Average:28.645; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0916234298 G -> C LOC_Os09g26720.1 downstream_gene_variant ; 407.0bp to feature; MODIFIER silent_mutation Average:28.645; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0916234298 G -> C LOC_Os09g26730.1 downstream_gene_variant ; 2140.0bp to feature; MODIFIER silent_mutation Average:28.645; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0916234298 G -> C LOC_Os09g26720-LOC_Os09g26730 intergenic_region ; MODIFIER silent_mutation Average:28.645; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916234298 1.56E-06 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 7.64E-06 5.88E-11 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 8.66E-06 8.66E-06 mr1276 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 NA 2.32E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 1.10E-10 9.79E-24 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 3.06E-08 2.21E-15 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 2.07E-10 5.66E-25 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 1.49E-08 1.52E-17 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 1.10E-10 1.13E-21 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 4.84E-10 2.16E-16 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 1.74E-11 NA mr1138_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 4.22E-10 1.81E-13 mr1138_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 2.56E-07 2.24E-08 mr1354_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 3.40E-15 2.99E-26 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 1.08E-11 7.27E-17 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 3.88E-17 2.76E-35 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 2.42E-13 1.15E-22 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 2.44E-14 1.29E-26 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 4.88E-13 1.64E-20 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 NA 9.73E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916234298 NA 9.90E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251