Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916231494:

Variant ID: vg0916231494 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16231494
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTAAAAATTACTAAAAAGGTACCGTTGGAAATGGTACCCCTTATACGGAAACGGCGTTCGGTCCATCGAGAATTTCCGTGACCATTTTCAAGTCTAG[T/G]
ATTAGTTTCTACTGAAAATGAAAATAAAGATGAAAACAACATTAGGAAATAAAAAACAAAGAAATCTTTAACATATGATTAATTAAATCTTAATTGTTAT

Reverse complement sequence

ATAACAATTAAGATTTAATTAATCATATGTTAAAGATTTCTTTGTTTTTTATTTCCTAATGTTGTTTTCATCTTTATTTTCATTTTCAGTAGAAACTAAT[A/C]
CTAGACTTGAAAATGGTCACGGAAATTCTCGATGGACCGAACGCCGTTTCCGTATAAGGGGTACCATTTCCAACGGTACCTTTTTAGTAATTTTTAAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	9.60%	0.97%	0.00%	NA
All Indica	2759	98.90%	0.90%	0.14%	0.00%	NA
All Japonica	1512	75.30%	22.40%	2.38%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.60%	2.00%	0.38%	0.00%	NA
Temperate Japonica	767	94.90%	2.90%	2.22%	0.00%	NA
Tropical Japonica	504	39.70%	58.10%	2.18%	0.00%	NA
Japonica Intermediate	241	87.10%	9.50%	3.32%	0.00%	NA
VI/Aromatic	96	22.90%	76.00%	1.04%	0.00%	NA
Intermediate	90	78.90%	15.60%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916231494	T -> G	LOC_Os09g26710.1	upstream_gene_variant ; 429.0bp to feature; MODIFIER	silent_mutation	Average:66.635; most accessible tissue: Callus, score: 92.76	N	N	N	N
vg0916231494	T -> G	LOC_Os09g26720.1	upstream_gene_variant ; 1435.0bp to feature; MODIFIER	silent_mutation	Average:66.635; most accessible tissue: Callus, score: 92.76	N	N	N	N
vg0916231494	T -> G	LOC_Os09g26700.1	downstream_gene_variant ; 1986.0bp to feature; MODIFIER	silent_mutation	Average:66.635; most accessible tissue: Callus, score: 92.76	N	N	N	N
vg0916231494	T -> G	LOC_Os09g26730.1	downstream_gene_variant ; 4944.0bp to feature; MODIFIER	silent_mutation	Average:66.635; most accessible tissue: Callus, score: 92.76	N	N	N	N
vg0916231494	T -> G	LOC_Os09g26700.2	downstream_gene_variant ; 3144.0bp to feature; MODIFIER	silent_mutation	Average:66.635; most accessible tissue: Callus, score: 92.76	N	N	N	N
vg0916231494	T -> G	LOC_Os09g26710-LOC_Os09g26720	intergenic_region ; MODIFIER	silent_mutation	Average:66.635; most accessible tissue: Callus, score: 92.76	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916231494	NA	2.13E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916231494	3.34E-06	3.34E-06	mr1162_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251