\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916221666:

Variant ID: vg0916221666 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16221666
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACACATAAATATTCATAATAAAATTTCACTCATTATATAAGAAGGTGTCCGCGCATGTGCGCGGGCTATCTTTCTAGTTGAAACAAAAGTTGTTCAAC[C/G]
TAGCTAGGGTCAGGGATCACCGGTGTCGTCGTATTCGCCTTCGATCGGGGCTGTATTCCGTGCACTTCACCCTGCAAACCACGTCGCCACTGTTACTGTC

Reverse complement sequence

GACAGTAACAGTGGCGACGTGGTTTGCAGGGTGAAGTGCACGGAATACAGCCCCGATCGAAGGCGAATACGACGACACCGGTGATCCCTGACCCTAGCTA[G/C]
GTTGAACAACTTTTGTTTCAACTAGAAAGATAGCCCGCGCACATGCGCGGACACCTTCTTATATAATGAGTGAAATTTTATTATGAATATTTATGTGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 6.20% 0.15% 0.00% NA
All Indica  2759 89.30% 10.50% 0.25% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 64.90% 34.50% 0.67% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 91.10% 8.50% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916221666 C -> G LOC_Os09g26700.1 upstream_gene_variant ; 3292.0bp to feature; MODIFIER silent_mutation Average:51.787; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0916221666 C -> G LOC_Os09g26700.2 upstream_gene_variant ; 3292.0bp to feature; MODIFIER silent_mutation Average:51.787; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0916221666 C -> G LOC_Os09g26690-LOC_Os09g26700 intergenic_region ; MODIFIER silent_mutation Average:51.787; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916221666 1.43E-07 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 3.50E-07 6.83E-11 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 4.07E-12 2.37E-24 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 3.55E-09 1.37E-15 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 1.21E-13 6.00E-28 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 2.49E-11 1.56E-19 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 1.94E-10 2.88E-21 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 1.08E-09 1.47E-15 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 NA 3.91E-06 mr1136_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 3.66E-11 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 3.10E-10 1.74E-12 mr1138_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 1.47E-06 2.03E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 9.44E-13 7.92E-23 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 9.75E-10 2.96E-14 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 8.19E-15 1.09E-33 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 1.30E-11 6.78E-21 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 6.42E-12 1.02E-24 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 7.58E-11 2.00E-18 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 NA 3.46E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 NA 9.33E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 NA 9.37E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916221666 NA 2.06E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251