Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0916213257:

Variant ID: vg0916213257 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16213257
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

TAACAAAGCTCTCTGTCTACCCTTACAAACTGTGTCATACTTAATTGTACACTTGTGATCCTCTTGCAACCTTATCATCAAGCTTTTAGGGCCCATACCT[G/A]
GATTAGTCTTTAAGATCTTCACAGCCTTTGAAGCAACCCATTTGGTAGTTGGTGTAGTGGTCCTCCTTCTGCTGCTAGATGTACAGGTATGAAAATCTGT

Reverse complement sequence

ACAGATTTTCATACCTGTACATCTAGCAGCAGAAGGAGGACCACTACACCAACTACCAAATGGGTTGCTTCAAAGGCTGTGAAGATCTTAAAGACTAATC[C/T]
AGGTATGGGCCCTAAAAGCTTGATGATAAGGTTGCAAGAGGATCACAAGTGTACAATTAAGTATGACACAGTTTGTAAGGGTAGACAGAGAGCTTTGTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.90%	5.50%	0.63%	0.00%	NA
All Indica	2759	89.60%	9.30%	1.09%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	65.50%	30.40%	4.03%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	91.70%	7.50%	0.76%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916213257	G -> A	LOC_Os09g26690.1	missense_variant ; p.Pro323Leu; MODERATE	nonsynonymous_codon ; P323L	Average:43.217; most accessible tissue: Minghui63 young leaf, score: 57.221	unknown	unknown	DELETERIOUS	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916213257	1.08E-07	NA	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	4.99E-07	3.03E-12	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	NA	6.51E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	3.41E-14	8.67E-27	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	1.41E-10	2.69E-17	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	1.47E-15	2.38E-31	mr1728	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	9.93E-13	4.37E-22	mr1728	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	NA	8.45E-06	mr1803	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	5.06E-09	2.53E-20	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	1.79E-08	7.66E-15	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	3.85E-08	NA	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	1.85E-06	6.60E-12	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	NA	2.53E-07	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	1.69E-07	3.40E-20	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	8.86E-06	2.68E-12	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	1.46E-12	6.51E-35	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	1.43E-09	1.26E-21	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	3.63E-08	1.21E-22	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	1.01E-07	1.46E-16	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	NA	2.31E-08	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916213257	NA	5.99E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251