Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916209376:

Variant ID: vg0916209376 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 16209376
Reference Allele: C	Alternative Allele: T,CT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATAGCTGTGTATGGCATGCAGGTAGGTTCAGACTTCAGTGTCTCCTGTCTTCGAATTCCTTCTTGGGGCTGTTTGGTTTTCAGGGACTTATTTCAAGTC[C/T,CT]
CTGTCATATCGGATATTTAGACATTAATTTGGAATATTAAACATATACTAATTACAAAATCCATTCCATAAGCTTGAACTAATTCGCGAGACGAATCTTT

Reverse complement sequence

AAAGATTCGTCTCGCGAATTAGTTCAAGCTTATGGAATGGATTTTGTAATTAGTATATGTTTAATATTCCAAATTAATGTCTAAATATCCGATATGACAG[G/A,AG]
GACTTGAAATAAGTCCCTGAAAACCAAACAGCCCCAAGAAGGAATTCGAAGACAGGAGACACTGAAGTCTGAACCTACCTGCATGCCATACACAGCTATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	6.90%	0.91%	4.68%	CT: 0.32%
All Indica	2759	85.90%	11.30%	0.47%	2.21%	CT: 0.07%
All Japonica	1512	99.90%	0.00%	0.00%	0.07%	NA
Aus	269	23.80%	3.30%	10.78%	57.62%	CT: 4.46%
Indica I	595	61.30%	36.10%	0.34%	2.18%	NA
Indica II	465	95.50%	2.40%	0.00%	2.15%	NA
Indica III	913	97.20%	1.10%	0.55%	1.20%	NA
Indica Intermediate	786	85.80%	9.80%	0.76%	3.44%	CT: 0.25%
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	92.20%	3.30%	1.11%	2.22%	CT: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916209376	C -> CT	LOC_Os09g26690.1	downstream_gene_variant ; 2222.0bp to feature; MODIFIER	silent_mutation	Average:52.463; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916209376	C -> CT	LOC_Os09g26680.1	intron_variant ; MODIFIER	silent_mutation	Average:52.463; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916209376	C -> DEL	N	N	silent_mutation	Average:52.463; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916209376	C -> T	LOC_Os09g26690.1	downstream_gene_variant ; 2223.0bp to feature; MODIFIER	silent_mutation	Average:52.463; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916209376	C -> T	LOC_Os09g26680.1	intron_variant ; MODIFIER	silent_mutation	Average:52.463; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916209376	6.76E-08	NA	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	2.93E-07	8.66E-12	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	NA	4.12E-07	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	3.50E-12	1.34E-24	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	3.50E-09	1.12E-15	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	5.95E-14	9.93E-29	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	2.22E-11	5.47E-20	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	1.96E-09	1.20E-20	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	9.87E-09	8.20E-15	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	NA	4.01E-06	mr1136_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	5.17E-10	NA	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	6.74E-09	3.51E-12	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	1.63E-07	1.66E-08	mr1354_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	3.15E-11	5.37E-21	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	1.38E-08	6.49E-13	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	3.80E-14	1.44E-33	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	4.74E-11	1.59E-20	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	1.65E-10	9.99E-24	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	1.05E-09	1.97E-17	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	NA	6.45E-09	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	NA	2.24E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	NA	8.75E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916209376	NA	9.72E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251