\
| Variant ID: vg0916209370 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 16209370 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTGATAGATAGCTGTGTATGGCATGCAGGTAGGTTCAGACTTCAGTGTCTCCTGTCTTCGAATTCCTTCTTGGGGCTGTTTGGTTTTCAGGGACTTATTT[C/T,A]
AAGTCCCTGTCATATCGGATATTTAGACATTAATTTGGAATATTAAACATATACTAATTACAAAATCCATTCCATAAGCTTGAACTAATTCGCGAGACGA
TCGTCTCGCGAATTAGTTCAAGCTTATGGAATGGATTTTGTAATTAGTATATGTTTAATATTCCAAATTAATGTCTAAATATCCGATATGACAGGGACTT[G/A,T]
AAATAAGTCCCTGAAAACCAAACAGCCCCAAGAAGGAATTCGAAGACAGGAGACACTGAAGTCTGAACCTACCTGCATGCCATACACAGCTATCTATCAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.50% | 35.90% | 1.10% | 4.68% | A: 0.89% |
| All Indica | 2759 | 94.60% | 1.80% | 0.69% | 2.50% | A: 0.40% |
| All Japonica | 1512 | 0.60% | 99.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 24.20% | 0.70% | 9.29% | 55.02% | A: 10.78% |
| Indica I | 595 | 96.60% | 0.30% | 0.67% | 2.35% | NA |
| Indica II | 465 | 95.50% | 1.50% | 0.43% | 2.15% | A: 0.43% |
| Indica III | 913 | 96.60% | 1.20% | 0.66% | 1.31% | A: 0.22% |
| Indica Intermediate | 786 | 90.10% | 3.90% | 0.89% | 4.20% | A: 0.89% |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 93.80% | 0.00% | 1.04% | A: 1.04% |
| Intermediate | 90 | 32.20% | 57.80% | 5.56% | 3.33% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916209370 | C -> DEL | N | N | silent_mutation | Average:51.849; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0916209370 | C -> T | LOC_Os09g26690.1 | downstream_gene_variant ; 2229.0bp to feature; MODIFIER | silent_mutation | Average:51.849; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0916209370 | C -> T | LOC_Os09g26680.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.849; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0916209370 | C -> A | LOC_Os09g26690.1 | downstream_gene_variant ; 2229.0bp to feature; MODIFIER | silent_mutation | Average:51.849; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0916209370 | C -> A | LOC_Os09g26680.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.849; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916209370 | NA | 1.63E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 2.24E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 5.20E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 1.16E-08 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 6.30E-08 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 3.02E-07 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 9.85E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 2.97E-06 | mr1289 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 2.82E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 2.26E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 3.02E-06 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 8.48E-07 | mr1651 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 5.27E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 4.87E-10 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | 7.69E-06 | 3.21E-10 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 5.35E-12 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 5.43E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | 7.21E-06 | NA | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | 2.36E-07 | 1.78E-13 | mr1860 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 6.20E-08 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | 3.09E-06 | 3.08E-06 | mr1978 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | 4.78E-06 | NA | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | 8.78E-06 | 6.08E-10 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 4.99E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 5.49E-06 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 3.70E-07 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 3.51E-08 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | 8.67E-06 | NA | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 3.44E-08 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | 6.30E-06 | NA | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 1.24E-11 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | 4.09E-07 | NA | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | 1.41E-06 | 7.95E-14 | mr1860_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 1.58E-09 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 4.44E-08 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 9.51E-06 | mr1899_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 6.69E-07 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 1.30E-06 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916209370 | NA | 1.15E-14 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |