\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916156198:

Variant ID: vg0916156198 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16156198
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTGTTCGTGACCTAAGGTCACAACACATATAATCAAAACATACTCTCACTTAATTATACAACTTCAGTGTATGTTATTTTCTATCGAAGCTAAGAGT[A/T]
AAATAAATGTAATACTCAACCAATAAACTGACCTTATGTTCTGTTAAAGTAATAATCGTTTTAGTAATTCTTGAAATAAAAATCTTCAACCGCATATTCT

Reverse complement sequence

AGAATATGCGGTTGAAGATTTTTATTTCAAGAATTACTAAAACGATTATTACTTTAACAGAACATAAGGTCAGTTTATTGGTTGAGTATTACATTTATTT[T/A]
ACTCTTAGCTTCGATAGAAAATAACATACACTGAAGTTGTATAATTAAGTGAGAGTATGTTTTGATTATATGTGTTGTGACCTTAGGTCACGAACAAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 7.50% 0.61% 0.00% NA
All Indica  2759 99.80% 0.20% 0.04% 0.00% NA
All Japonica  1512 75.40% 22.90% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 96.50% 2.50% 1.04% 0.00% NA
Tropical Japonica  504 46.80% 51.40% 1.79% 0.00% NA
Japonica Intermediate  241 68.00% 28.20% 3.73% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916156198 A -> T LOC_Os09g26630.1 upstream_gene_variant ; 1445.0bp to feature; MODIFIER silent_mutation Average:39.082; most accessible tissue: Callus, score: 70.442 N N N N
vg0916156198 A -> T LOC_Os09g26620.1 downstream_gene_variant ; 1028.0bp to feature; MODIFIER silent_mutation Average:39.082; most accessible tissue: Callus, score: 70.442 N N N N
vg0916156198 A -> T LOC_Os09g26620.5 downstream_gene_variant ; 1028.0bp to feature; MODIFIER silent_mutation Average:39.082; most accessible tissue: Callus, score: 70.442 N N N N
vg0916156198 A -> T LOC_Os09g26620.2 downstream_gene_variant ; 1028.0bp to feature; MODIFIER silent_mutation Average:39.082; most accessible tissue: Callus, score: 70.442 N N N N
vg0916156198 A -> T LOC_Os09g26620.3 downstream_gene_variant ; 1028.0bp to feature; MODIFIER silent_mutation Average:39.082; most accessible tissue: Callus, score: 70.442 N N N N
vg0916156198 A -> T LOC_Os09g26620.4 downstream_gene_variant ; 1028.0bp to feature; MODIFIER silent_mutation Average:39.082; most accessible tissue: Callus, score: 70.442 N N N N
vg0916156198 A -> T LOC_Os09g26620-LOC_Os09g26630 intergenic_region ; MODIFIER silent_mutation Average:39.082; most accessible tissue: Callus, score: 70.442 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916156198 7.62E-06 NA mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916156198 2.14E-07 1.74E-10 mr1696 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916156198 NA 2.26E-09 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916156198 NA 5.84E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251