Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916119204:

Variant ID: vg0916119204 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16119204
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGGAACTGCCGCCGCCGGCCCCGCTGTCACCGTGGCCGTCCCCGCGCCTCGCCGTCGCCGGATCCCGCCACCCCTGCCGCCGAACACCCACAGCCGCT[G/A]
AGGGAGAGAGGGAGAGGAGAGCTGAGGGCTACTGAGGGAAATGAGAGGTGAGGGAGAATTGAGGAGATAAGACTTAGGAAAAAAATTAGCGATGTGGCGC

Reverse complement sequence

GCGCCACATCGCTAATTTTTTTCCTAAGTCTTATCTCCTCAATTCTCCCTCACCTCTCATTTCCCTCAGTAGCCCTCAGCTCTCCTCTCCCTCTCTCCCT[C/T]
AGCGGCTGTGGGTGTTCGGCGGCAGGGGTGGCGGGATCCGGCGACGGCGAGGCGCGGGGACGGCCACGGTGACAGCGGGGCCGGCGGCGGCAGTTCCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 6.20% 0.00% 0.00% NA
All Indica  2759 89.50% 10.50% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 67.60% 32.40% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 91.60% 8.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916119204 G -> A LOC_Os09g26580-LOC_Os09g26590 intergenic_region ; MODIFIER silent_mutation Average:73.312; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916119204 NA 2.76E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 1.96E-08 3.38E-20 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 2.01E-06 1.14E-12 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 2.33E-11 2.50E-25 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 2.65E-09 1.29E-17 mr1728 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 4.71E-06 1.88E-15 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 NA 8.24E-11 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 NA 2.54E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 NA 4.56E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 4.17E-06 1.14E-17 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 NA 9.85E-11 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 1.59E-07 7.99E-27 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 5.82E-06 3.49E-16 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 7.22E-06 2.92E-18 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 NA 4.72E-13 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 NA 2.04E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916119204 NA 6.69E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251