\
| Variant ID: vg0916109756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 16109756 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 218. )
AACATGACCACCTTAAATAAAAGAAGCTATCCACTCACACCATTTAGGAGAGAAACCCTTCATCCTCAACGTTTGTTGTACAAAGGACCATTTTACTTTA[T/A]
CATAAACTTTTTCAAAATCAATCTTAAAGATTACACCGCTTTTGTCTTTACAATGTAATTCATGCATAGTCTCATGTAAAATAACCACTCCTTCCATAAT
ATTATGGAAGGAGTGGTTATTTTACATGAGACTATGCATGAATTACATTGTAAAGACAAAAGCGGTGTAATCTTTAAGATTGATTTTGAAAAAGTTTATG[A/T]
TAAAGTAAAATGGTCCTTTGTACAACAAACGTTGAGGATGAAGGGTTTCTCTCCTAAATGGTGTGAGTGGATAGCTTCTTTTATTTAAGGTGGTCATGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 6.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 89.60% | 10.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.90% | 31.40% | 0.67% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916109756 | T -> A | LOC_Os09g26580-LOC_Os09g26590 | intergenic_region ; MODIFIER | silent_mutation | Average:24.523; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916109756 | 2.17E-06 | NA | mr1380 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | 3.38E-06 | NA | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | 7.75E-06 | NA | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | 6.97E-06 | 3.61E-15 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 2.85E-09 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | 4.48E-06 | 7.17E-17 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 1.76E-11 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 6.16E-11 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 1.59E-07 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | 6.66E-06 | NA | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 3.59E-13 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 8.48E-08 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 6.64E-18 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 2.16E-10 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 2.23E-13 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 2.84E-09 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916109756 | NA | 6.06E-07 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |