Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916109500:

Variant ID: vg0916109500 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16109500
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

ATATATTTGTTCCTCTCAACATAACCATTGTTAATTAAAGCTAGATACATTGACCTTACTGAGAACCTACCATTCTGATGATAATTCCATCTAAAATAGT[C/T,A]
AGAAGAAGGATTTAATTGAATACGTATAATAGAAGCACACAATTCATGCCAGTATACAAGATTCTGACCAACTAAAGCTTTTATAAAAGAAACATTAAGC

Reverse complement sequence

GCTTAATGTTTCTTTTATAAAAGCTTTAGTTGGTCAGAATCTTGTATACTGGCATGAATTGTGTGCTTCTATTATACGTATTCAATTAAATCCTTCTTCT[G/A,T]
ACTATTTTAGATGGAATTATCATCAGAATGGTAGGTTCTCAGTAAGGTCAATGTATCTAGCTTTAATTAACAATGGTTATGTTGAGAGGAACAAATATAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.70%	7.90%	0.99%	0.00%	A: 0.44%
All Indica	2759	99.60%	0.20%	0.11%	0.00%	A: 0.11%
All Japonica	1512	73.80%	23.50%	2.65%	0.00%	A: 0.07%
Aus	269	93.70%	0.00%	0.00%	0.00%	A: 6.32%
Indica I	595	99.80%	0.00%	0.00%	0.00%	A: 0.17%
Indica II	465	98.90%	0.60%	0.43%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.30%	0.13%	0.00%	A: 0.25%
Temperate Japonica	767	57.60%	37.50%	4.82%	0.00%	NA
Tropical Japonica	504	95.40%	4.20%	0.20%	0.00%	A: 0.20%
Japonica Intermediate	241	80.10%	19.10%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	12.20%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916109500	C -> T	LOC_Os09g26580-LOC_Os09g26590	intergenic_region ; MODIFIER	silent_mutation	Average:23.367; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0916109500	C -> A	LOC_Os09g26580-LOC_Os09g26590	intergenic_region ; MODIFIER	silent_mutation	Average:23.367; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916109500	NA	9.57E-07	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	1.16E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	4.46E-06	4.46E-06	mr1249	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	3.22E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	1.56E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	2.66E-09	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	9.65E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	9.77E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	1.51E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	6.09E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	1.25E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	1.28E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500	NA	1.78E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251