\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916109500:

Variant ID: vg0916109500 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16109500
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATTTGTTCCTCTCAACATAACCATTGTTAATTAAAGCTAGATACATTGACCTTACTGAGAACCTACCATTCTGATGATAATTCCATCTAAAATAGT[C/T,A]
AGAAGAAGGATTTAATTGAATACGTATAATAGAAGCACACAATTCATGCCAGTATACAAGATTCTGACCAACTAAAGCTTTTATAAAAGAAACATTAAGC

Reverse complement sequence

GCTTAATGTTTCTTTTATAAAAGCTTTAGTTGGTCAGAATCTTGTATACTGGCATGAATTGTGTGCTTCTATTATACGTATTCAATTAAATCCTTCTTCT[G/A,T]
ACTATTTTAGATGGAATTATCATCAGAATGGTAGGTTCTCAGTAAGGTCAATGTATCTAGCTTTAATTAACAATGGTTATGTTGAGAGGAACAAATATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 7.90% 0.99% 0.00% A: 0.44%
All Indica  2759 99.60% 0.20% 0.11% 0.00% A: 0.11%
All Japonica  1512 73.80% 23.50% 2.65% 0.00% A: 0.07%
Aus  269 93.70% 0.00% 0.00% 0.00% A: 6.32%
Indica I  595 99.80% 0.00% 0.00% 0.00% A: 0.17%
Indica II  465 98.90% 0.60% 0.43% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.30% 0.13% 0.00% A: 0.25%
Temperate Japonica  767 57.60% 37.50% 4.82% 0.00% NA
Tropical Japonica  504 95.40% 4.20% 0.20% 0.00% A: 0.20%
Japonica Intermediate  241 80.10% 19.10% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 12.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916109500 C -> T LOC_Os09g26580-LOC_Os09g26590 intergenic_region ; MODIFIER silent_mutation Average:23.367; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0916109500 C -> A LOC_Os09g26580-LOC_Os09g26590 intergenic_region ; MODIFIER silent_mutation Average:23.367; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916109500 NA 9.57E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 1.16E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 4.46E-06 4.46E-06 mr1249 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 3.22E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 1.56E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 2.66E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 9.65E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 9.77E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 1.51E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 6.09E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 1.25E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 1.28E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916109500 NA 1.78E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251