Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916081853:

Variant ID: vg0916081853 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16081853
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTAAGCAGAACTTCTGTGTTGCAAATGTATCTCTCCTGACCAGCAGAAAAAATTAACATGCATAATTGGGTTGCATGTTTTGTTTAAGTCATAGCAGA[G/A]
TAATCCAACTGTATCTCTTCAAGAGTTGACAAACATCAACATGCACAGTTAAGTTATAGATCTCATCAATCATAATGGTGTAATATTAGTCATAAGTACC

Reverse complement sequence

GGTACTTATGACTAATATTACACCATTATGATTGATGAGATCTATAACTTAACTGTGCATGTTGATGTTTGTCAACTCTTGAAGAGATACAGTTGGATTA[C/T]
TCTGCTATGACTTAAACAAAACATGCAACCCAATTATGCATGTTAATTTTTTCTGCTGGTCAGGAGAGATACATTTGCAACACAGAAGTTCTGCTTAGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.50%	22.60%	1.93%	0.00%	NA
All Indica	2759	98.60%	1.20%	0.25%	0.00%	NA
All Japonica	1512	28.40%	66.30%	5.36%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	98.70%	1.10%	0.22%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	2.70%	0.64%	0.00%	NA
Temperate Japonica	767	28.20%	63.80%	8.08%	0.00%	NA
Tropical Japonica	504	16.90%	80.60%	2.58%	0.00%	NA
Japonica Intermediate	241	53.10%	44.40%	2.49%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	68.90%	27.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916081853	G -> A	LOC_Os09g26554.1	downstream_gene_variant ; 3417.0bp to feature; MODIFIER	silent_mutation	Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0916081853	G -> A	LOC_Os09g26554.2	downstream_gene_variant ; 3417.0bp to feature; MODIFIER	silent_mutation	Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0916081853	G -> A	LOC_Os09g26560.2	intron_variant ; MODIFIER	silent_mutation	Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0916081853	G -> A	LOC_Os09g26560.1	intron_variant ; MODIFIER	silent_mutation	Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916081853	NA	9.60E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853	6.51E-06	6.51E-06	mr1831_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853	NA	3.69E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853	3.81E-06	3.81E-06	mr1840_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853	NA	6.04E-06	mr1849_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853	NA	8.44E-06	mr1923_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853	1.78E-06	1.78E-06	mr1934_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251