| Variant ID: vg0916081853 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 16081853 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )
ATCTAAGCAGAACTTCTGTGTTGCAAATGTATCTCTCCTGACCAGCAGAAAAAATTAACATGCATAATTGGGTTGCATGTTTTGTTTAAGTCATAGCAGA[G/A]
TAATCCAACTGTATCTCTTCAAGAGTTGACAAACATCAACATGCACAGTTAAGTTATAGATCTCATCAATCATAATGGTGTAATATTAGTCATAAGTACC
GGTACTTATGACTAATATTACACCATTATGATTGATGAGATCTATAACTTAACTGTGCATGTTGATGTTTGTCAACTCTTGAAGAGATACAGTTGGATTA[C/T]
TCTGCTATGACTTAAACAAAACATGCAACCCAATTATGCATGTTAATTTTTTCTGCTGGTCAGGAGAGATACATTTGCAACACAGAAGTTCTGCTTAGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.50% | 22.60% | 1.93% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.20% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 28.40% | 66.30% | 5.36% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 2.70% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 28.20% | 63.80% | 8.08% | 0.00% | NA |
| Tropical Japonica | 504 | 16.90% | 80.60% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.10% | 44.40% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 27.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916081853 | G -> A | LOC_Os09g26554.1 | downstream_gene_variant ; 3417.0bp to feature; MODIFIER | silent_mutation | Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663 | N | N | N | N |
| vg0916081853 | G -> A | LOC_Os09g26554.2 | downstream_gene_variant ; 3417.0bp to feature; MODIFIER | silent_mutation | Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663 | N | N | N | N |
| vg0916081853 | G -> A | LOC_Os09g26560.2 | intron_variant ; MODIFIER | silent_mutation | Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663 | N | N | N | N |
| vg0916081853 | G -> A | LOC_Os09g26560.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916081853 | NA | 9.60E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916081853 | 6.51E-06 | 6.51E-06 | mr1831_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916081853 | NA | 3.69E-07 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916081853 | 3.81E-06 | 3.81E-06 | mr1840_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916081853 | NA | 6.04E-06 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916081853 | NA | 8.44E-06 | mr1923_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916081853 | 1.78E-06 | 1.78E-06 | mr1934_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |