\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916081853:

Variant ID: vg0916081853 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16081853
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTAAGCAGAACTTCTGTGTTGCAAATGTATCTCTCCTGACCAGCAGAAAAAATTAACATGCATAATTGGGTTGCATGTTTTGTTTAAGTCATAGCAGA[G/A]
TAATCCAACTGTATCTCTTCAAGAGTTGACAAACATCAACATGCACAGTTAAGTTATAGATCTCATCAATCATAATGGTGTAATATTAGTCATAAGTACC

Reverse complement sequence

GGTACTTATGACTAATATTACACCATTATGATTGATGAGATCTATAACTTAACTGTGCATGTTGATGTTTGTCAACTCTTGAAGAGATACAGTTGGATTA[C/T]
TCTGCTATGACTTAAACAAAACATGCAACCCAATTATGCATGTTAATTTTTTCTGCTGGTCAGGAGAGATACATTTGCAACACAGAAGTTCTGCTTAGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.50% 22.60% 1.93% 0.00% NA
All Indica  2759 98.60% 1.20% 0.25% 0.00% NA
All Japonica  1512 28.40% 66.30% 5.36% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 2.70% 0.64% 0.00% NA
Temperate Japonica  767 28.20% 63.80% 8.08% 0.00% NA
Tropical Japonica  504 16.90% 80.60% 2.58% 0.00% NA
Japonica Intermediate  241 53.10% 44.40% 2.49% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 68.90% 27.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916081853 G -> A LOC_Os09g26554.1 downstream_gene_variant ; 3417.0bp to feature; MODIFIER silent_mutation Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0916081853 G -> A LOC_Os09g26554.2 downstream_gene_variant ; 3417.0bp to feature; MODIFIER silent_mutation Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0916081853 G -> A LOC_Os09g26560.2 intron_variant ; MODIFIER silent_mutation Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0916081853 G -> A LOC_Os09g26560.1 intron_variant ; MODIFIER silent_mutation Average:41.937; most accessible tissue: Minghui63 flower, score: 56.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916081853 NA 9.60E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853 6.51E-06 6.51E-06 mr1831_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853 NA 3.69E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853 3.81E-06 3.81E-06 mr1840_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853 NA 6.04E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853 NA 8.44E-06 mr1923_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916081853 1.78E-06 1.78E-06 mr1934_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251