\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916062859:

Variant ID: vg0916062859 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16062859
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTATTTAGATAATCAACATCCTTACTCCTACAGTAACTGAATTGCCTAATGTAAATTTCCAGGATGTTCATGTAGTTAGCTCCCAACCAAAGTGGAATT[T/G]
GGTTTTTGTTCGTATACTTCAACAATGTGAATTTTTTTCCTGCAGTAACCTTGGTTTTTGTTCCTGCAGTAATTGAATTTCCAGGATGTGAATTTTCAGG

Reverse complement sequence

CCTGAAAATTCACATCCTGGAAATTCAATTACTGCAGGAACAAAAACCAAGGTTACTGCAGGAAAAAAATTCACATTGTTGAAGTATACGAACAAAAACC[A/C]
AATTCCACTTTGGTTGGGAGCTAACTACATGAACATCCTGGAAATTTACATTAGGCAATTCAGTTACTGTAGGAGTAAGGATGTTGATTATCTAAATAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.50% 6.30% 0.87% 51.40% NA
All Indica  2759 8.40% 10.40% 1.30% 79.85% NA
All Japonica  1512 99.30% 0.00% 0.00% 0.73% NA
Aus  269 26.80% 1.90% 1.86% 69.52% NA
Indica I  595 7.10% 33.40% 0.67% 58.82% NA
Indica II  465 11.20% 2.20% 1.72% 84.95% NA
Indica III  913 5.00% 0.50% 1.10% 93.32% NA
Indica Intermediate  786 11.80% 9.30% 1.78% 77.10% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 98.60% 0.00% 0.00% 1.39% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 66.70% 3.30% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916062859 T -> G LOC_Os09g26550.2 downstream_gene_variant ; 3558.0bp to feature; MODIFIER silent_mutation Average:21.318; most accessible tissue: Minghui63 flower, score: 46.748 N N N N
vg0916062859 T -> G LOC_Os09g26550-LOC_Os09g26554 intergenic_region ; MODIFIER silent_mutation Average:21.318; most accessible tissue: Minghui63 flower, score: 46.748 N N N N
vg0916062859 T -> DEL N N silent_mutation Average:21.318; most accessible tissue: Minghui63 flower, score: 46.748 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916062859 NA 1.67E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 4.06E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 7.43E-08 2.18E-20 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 6.91E-06 6.95E-13 mr1707 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 5.02E-10 9.82E-25 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 7.33E-08 2.92E-17 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 6.84E-07 7.68E-17 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 2.24E-06 6.08E-12 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 2.18E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 3.21E-06 mr1348_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 4.22E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 3.05E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 3.55E-06 9.78E-18 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 7.80E-11 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 7.45E-07 1.65E-26 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 4.87E-16 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 1.69E-17 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 1.73E-12 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 1.37E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 5.11E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062859 NA 7.71E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251