\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916062006:

Variant ID: vg0916062006 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16062006
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAGTGTACTACTTAACATTTTTATATAAATAATATCGTGGTTGTGATTGGGCATCTACTGGAAAAGAACTGGTAGGTCAATGAATCCATTACGGTGCTT[G/C]
TGTTGCAGGGATAGTTCTCTCGTGTTGCACTCCAGGTGTTTGTAGTTTTGCCTTACGGAAGAGTAGTTTCAGTTCTGCTCCATGGCTTGCAGTGGTTGAT

Reverse complement sequence

ATCAACCACTGCAAGCCATGGAGCAGAACTGAAACTACTCTTCCGTAAGGCAAAACTACAAACACCTGGAGTGCAACACGAGAGAACTATCCCTGCAACA[C/G]
AAGCACCGTAATGGATTCATTGACCTACCAGTTCTTTTCCAGTAGATGCCCAATCACAACCACGATATTATTTATATAAAAATGTTAAGTAGTACACTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.20% 6.30% 0.36% 52.14% NA
All Indica  2759 8.20% 10.40% 0.54% 80.83% NA
All Japonica  1512 99.30% 0.00% 0.00% 0.73% NA
Aus  269 24.90% 1.90% 0.74% 72.49% NA
Indica I  595 6.90% 33.60% 0.50% 58.99% NA
Indica II  465 10.50% 2.20% 0.86% 86.45% NA
Indica III  913 4.70% 0.50% 0.22% 94.52% NA
Indica Intermediate  786 11.80% 9.30% 0.76% 78.12% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 98.60% 0.00% 0.00% 1.39% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 66.70% 3.30% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916062006 G -> DEL N N silent_mutation Average:37.581; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0916062006 G -> C LOC_Os09g26550.2 downstream_gene_variant ; 2705.0bp to feature; MODIFIER silent_mutation Average:37.581; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0916062006 G -> C LOC_Os09g26550-LOC_Os09g26554 intergenic_region ; MODIFIER silent_mutation Average:37.581; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916062006 NA 2.17E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 3.10E-07 3.32E-20 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 1.05E-12 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 2.31E-09 2.81E-24 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 2.36E-07 7.79E-17 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 3.95E-06 1.81E-16 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 1.48E-11 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 1.57E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 1.76E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 9.19E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 7.73E-06 7.63E-18 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 7.13E-11 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 4.95E-07 9.97E-28 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 8.87E-17 mr1728_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 1.53E-18 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 2.73E-13 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 1.22E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 4.64E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916062006 NA 9.22E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251