Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916048599:

Variant ID: vg0916048599 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16048599
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCGAATATGGATACAAACTCGGATAATGTCGGGCAAAAATACGAAACAAATATGTACCAAAATGCATACGTACACTATCGGTTACGAATATTTATTTG[G/A]
ATATCAAGTTGAAGCAACAATCTTATATATCATATAGACAATAACCATTTAACAATTTCATATATCCATAATACGATATATTAGGCTATTAGGACCTTAT

Reverse complement sequence

ATAAGGTCCTAATAGCCTAATATATCGTATTATGGATATATGAAATTGTTAAATGGTTATTGTCTATATGATATATAAGATTGTTGCTTCAACTTGATAT[C/T]
CAAATAAATATTCGTAACCGATAGTGTACGTATGCATTTTGGTACATATTTGTTTCGTATTTTTGCCCGACATTATCCGAGTTTGTATCCATATTCGGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.30%	6.20%	0.66%	51.93%	NA
All Indica	2759	8.20%	10.20%	1.12%	80.50%	NA
All Japonica	1512	99.30%	0.00%	0.00%	0.66%	NA
Aus	269	25.30%	1.90%	0.00%	72.86%	NA
Indica I	595	6.70%	33.30%	0.34%	59.66%	NA
Indica II	465	10.80%	1.90%	1.51%	85.81%	NA
Indica III	913	5.10%	0.40%	1.10%	93.32%	NA
Indica Intermediate	786	11.20%	9.00%	1.53%	78.24%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	98.80%	0.00%	0.00%	1.19%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	67.80%	3.30%	0.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916048599	G -> DEL	N	N	silent_mutation	Average:34.37; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0916048599	G -> A	LOC_Os09g26540.1	upstream_gene_variant ; 3132.0bp to feature; MODIFIER	silent_mutation	Average:34.37; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0916048599	G -> A	LOC_Os09g26550.2	upstream_gene_variant ; 539.0bp to feature; MODIFIER	silent_mutation	Average:34.37; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0916048599	G -> A	LOC_Os09g26540.2	upstream_gene_variant ; 3132.0bp to feature; MODIFIER	silent_mutation	Average:34.37; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0916048599	G -> A	LOC_Os09g26540-LOC_Os09g26550	intergenic_region ; MODIFIER	silent_mutation	Average:34.37; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916048599	2.43E-06	2.14E-18	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	2.15E-11	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	5.09E-10	1.61E-24	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	6.61E-08	5.27E-17	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	4.32E-15	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	1.77E-10	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	9.52E-06	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	5.66E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	1.86E-15	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	3.22E-09	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	5.45E-06	1.32E-24	mr1728_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	1.34E-14	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	1.28E-16	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	1.12E-11	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	1.61E-08	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	5.70E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599	NA	5.39E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251