\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916048599:

Variant ID: vg0916048599 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16048599
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCGAATATGGATACAAACTCGGATAATGTCGGGCAAAAATACGAAACAAATATGTACCAAAATGCATACGTACACTATCGGTTACGAATATTTATTTG[G/A]
ATATCAAGTTGAAGCAACAATCTTATATATCATATAGACAATAACCATTTAACAATTTCATATATCCATAATACGATATATTAGGCTATTAGGACCTTAT

Reverse complement sequence

ATAAGGTCCTAATAGCCTAATATATCGTATTATGGATATATGAAATTGTTAAATGGTTATTGTCTATATGATATATAAGATTGTTGCTTCAACTTGATAT[C/T]
CAAATAAATATTCGTAACCGATAGTGTACGTATGCATTTTGGTACATATTTGTTTCGTATTTTTGCCCGACATTATCCGAGTTTGTATCCATATTCGGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.30% 6.20% 0.66% 51.93% NA
All Indica  2759 8.20% 10.20% 1.12% 80.50% NA
All Japonica  1512 99.30% 0.00% 0.00% 0.66% NA
Aus  269 25.30% 1.90% 0.00% 72.86% NA
Indica I  595 6.70% 33.30% 0.34% 59.66% NA
Indica II  465 10.80% 1.90% 1.51% 85.81% NA
Indica III  913 5.10% 0.40% 1.10% 93.32% NA
Indica Intermediate  786 11.20% 9.00% 1.53% 78.24% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 98.80% 0.00% 0.00% 1.19% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 67.80% 3.30% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916048599 G -> DEL N N silent_mutation Average:34.37; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0916048599 G -> A LOC_Os09g26540.1 upstream_gene_variant ; 3132.0bp to feature; MODIFIER silent_mutation Average:34.37; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0916048599 G -> A LOC_Os09g26550.2 upstream_gene_variant ; 539.0bp to feature; MODIFIER silent_mutation Average:34.37; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0916048599 G -> A LOC_Os09g26540.2 upstream_gene_variant ; 3132.0bp to feature; MODIFIER silent_mutation Average:34.37; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0916048599 G -> A LOC_Os09g26540-LOC_Os09g26550 intergenic_region ; MODIFIER silent_mutation Average:34.37; most accessible tissue: Minghui63 root, score: 63.915 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916048599 2.43E-06 2.14E-18 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 2.15E-11 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 5.09E-10 1.61E-24 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 6.61E-08 5.27E-17 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 4.32E-15 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 1.77E-10 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 9.52E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 5.66E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 1.86E-15 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 3.22E-09 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 5.45E-06 1.32E-24 mr1728_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 1.34E-14 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 1.28E-16 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 1.12E-11 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 1.61E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 5.70E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916048599 NA 5.39E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251