\
| Variant ID: vg0916036140 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 16036140 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTTCATCTAAATTCAAATTTAAATTGATAAAAAAAGAAATAATGAAATAAAATCTTATAAATATTATGATATTCATAGAACTTATTGGGATATAAATTT[C/T]
CGAAAAAAATGATATATTGTGTGTATTTACTAAAACTTACATCATGAAAAAAAAGAATTTCAGCAAATTACCTCCATTACAAATTACTGATCGAAATTTC
GAAATTTCGATCAGTAATTTGTAATGGAGGTAATTTGCTGAAATTCTTTTTTTTCATGATGTAAGTTTTAGTAAATACACACAATATATCATTTTTTTCG[G/A]
AAATTTATATCCCAATAAGTTCTATGAATATCATAATATTTATAAGATTTTATTTCATTATTTCTTTTTTTATCAATTTAAATTTGAATTTAGATGAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.40% | 0.10% | 0.87% | 56.58% | NA |
| All Indica | 2759 | 10.30% | 0.30% | 1.12% | 88.37% | NA |
| All Japonica | 1512 | 99.20% | 0.00% | 0.20% | 0.60% | NA |
| Aus | 269 | 26.00% | 0.00% | 1.49% | 72.49% | NA |
| Indica I | 595 | 13.10% | 0.00% | 2.69% | 84.20% | NA |
| Indica II | 465 | 10.50% | 0.40% | 0.43% | 88.60% | NA |
| Indica III | 913 | 5.40% | 0.10% | 0.55% | 93.98% | NA |
| Indica Intermediate | 786 | 13.60% | 0.50% | 1.02% | 84.86% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 98.40% | 0.00% | 0.60% | 0.99% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 63.30% | 0.00% | 3.33% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916036140 | C -> DEL | N | N | silent_mutation | Average:19.021; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0916036140 | C -> T | LOC_Os09g26530.1 | upstream_gene_variant ; 785.0bp to feature; MODIFIER | silent_mutation | Average:19.021; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0916036140 | C -> T | LOC_Os09g26540.1 | downstream_gene_variant ; 2702.0bp to feature; MODIFIER | silent_mutation | Average:19.021; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0916036140 | C -> T | LOC_Os09g26540.2 | downstream_gene_variant ; 2702.0bp to feature; MODIFIER | silent_mutation | Average:19.021; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0916036140 | C -> T | LOC_Os09g26530-LOC_Os09g26540 | intergenic_region ; MODIFIER | silent_mutation | Average:19.021; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916036140 | NA | 5.04E-06 | mr1036 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916036140 | 3.02E-06 | NA | mr1237 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916036140 | NA | 2.42E-06 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916036140 | NA | 8.68E-06 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |