Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0916036140:

Variant ID: vg0916036140 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16036140
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTCATCTAAATTCAAATTTAAATTGATAAAAAAAGAAATAATGAAATAAAATCTTATAAATATTATGATATTCATAGAACTTATTGGGATATAAATTT[C/T]
CGAAAAAAATGATATATTGTGTGTATTTACTAAAACTTACATCATGAAAAAAAAGAATTTCAGCAAATTACCTCCATTACAAATTACTGATCGAAATTTC

Reverse complement sequence

GAAATTTCGATCAGTAATTTGTAATGGAGGTAATTTGCTGAAATTCTTTTTTTTCATGATGTAAGTTTTAGTAAATACACACAATATATCATTTTTTTCG[G/A]
AAATTTATATCCCAATAAGTTCTATGAATATCATAATATTTATAAGATTTTATTTCATTATTTCTTTTTTTATCAATTTAAATTTGAATTTAGATGAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.40%	0.10%	0.87%	56.58%	NA
All Indica	2759	10.30%	0.30%	1.12%	88.37%	NA
All Japonica	1512	99.20%	0.00%	0.20%	0.60%	NA
Aus	269	26.00%	0.00%	1.49%	72.49%	NA
Indica I	595	13.10%	0.00%	2.69%	84.20%	NA
Indica II	465	10.50%	0.40%	0.43%	88.60%	NA
Indica III	913	5.40%	0.10%	0.55%	93.98%	NA
Indica Intermediate	786	13.60%	0.50%	1.02%	84.86%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	98.40%	0.00%	0.60%	0.99%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	63.30%	0.00%	3.33%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916036140	C -> DEL	N	N	silent_mutation	Average:19.021; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N
vg0916036140	C -> T	LOC_Os09g26530.1	upstream_gene_variant ; 785.0bp to feature; MODIFIER	silent_mutation	Average:19.021; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N
vg0916036140	C -> T	LOC_Os09g26540.1	downstream_gene_variant ; 2702.0bp to feature; MODIFIER	silent_mutation	Average:19.021; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N
vg0916036140	C -> T	LOC_Os09g26540.2	downstream_gene_variant ; 2702.0bp to feature; MODIFIER	silent_mutation	Average:19.021; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N
vg0916036140	C -> T	LOC_Os09g26530-LOC_Os09g26540	intergenic_region ; MODIFIER	silent_mutation	Average:19.021; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916036140	NA	5.04E-06	mr1036	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036140	3.02E-06	NA	mr1237	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036140	NA	2.42E-06	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036140	NA	8.68E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251