\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916036140:

Variant ID: vg0916036140 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16036140
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTCATCTAAATTCAAATTTAAATTGATAAAAAAAGAAATAATGAAATAAAATCTTATAAATATTATGATATTCATAGAACTTATTGGGATATAAATTT[C/T]
CGAAAAAAATGATATATTGTGTGTATTTACTAAAACTTACATCATGAAAAAAAAGAATTTCAGCAAATTACCTCCATTACAAATTACTGATCGAAATTTC

Reverse complement sequence

GAAATTTCGATCAGTAATTTGTAATGGAGGTAATTTGCTGAAATTCTTTTTTTTCATGATGTAAGTTTTAGTAAATACACACAATATATCATTTTTTTCG[G/A]
AAATTTATATCCCAATAAGTTCTATGAATATCATAATATTTATAAGATTTTATTTCATTATTTCTTTTTTTATCAATTTAAATTTGAATTTAGATGAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 0.10% 0.87% 56.58% NA
All Indica  2759 10.30% 0.30% 1.12% 88.37% NA
All Japonica  1512 99.20% 0.00% 0.20% 0.60% NA
Aus  269 26.00% 0.00% 1.49% 72.49% NA
Indica I  595 13.10% 0.00% 2.69% 84.20% NA
Indica II  465 10.50% 0.40% 0.43% 88.60% NA
Indica III  913 5.40% 0.10% 0.55% 93.98% NA
Indica Intermediate  786 13.60% 0.50% 1.02% 84.86% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 98.40% 0.00% 0.60% 0.99% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 63.30% 0.00% 3.33% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916036140 C -> DEL N N silent_mutation Average:19.021; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0916036140 C -> T LOC_Os09g26530.1 upstream_gene_variant ; 785.0bp to feature; MODIFIER silent_mutation Average:19.021; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0916036140 C -> T LOC_Os09g26540.1 downstream_gene_variant ; 2702.0bp to feature; MODIFIER silent_mutation Average:19.021; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0916036140 C -> T LOC_Os09g26540.2 downstream_gene_variant ; 2702.0bp to feature; MODIFIER silent_mutation Average:19.021; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0916036140 C -> T LOC_Os09g26530-LOC_Os09g26540 intergenic_region ; MODIFIER silent_mutation Average:19.021; most accessible tissue: Minghui63 root, score: 41.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916036140 NA 5.04E-06 mr1036 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036140 3.02E-06 NA mr1237 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036140 NA 2.42E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036140 NA 8.68E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251