Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916032111:

Variant ID: vg0916032111 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16032111
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAGTGCTATGTAATGCCACACACTAAAAAAAGCACAAACTATACCATACAACATAAACATTTCATAAAATACTACTAAGTCTAGAACAGCAACACAA[T/G]
TTATAGAACATTTTCCAAAGCAATAAGCCCCACAAAACATTTTTGGAGTCTACATAAATGATAACTTACCGCTGACATTATTTGCAAAGCACCAATTACA

Reverse complement sequence

TGTAATTGGTGCTTTGCAAATAATGTCAGCGGTAAGTTATCATTTATGTAGACTCCAAAAATGTTTTGTGGGGCTTATTGCTTTGGAAAATGTTCTATAA[A/C]
TTGTGTTGCTGTTCTAGACTTAGTAGTATTTTATGAAATGTTTATGTTGTATGGTATAGTTTGTGCTTTTTTTAGTGTGTGGCATTACATAGCACTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.60%	6.30%	1.10%	50.99%	NA
All Indica	2759	8.80%	10.40%	1.63%	79.12%	NA
All Japonica	1512	99.30%	0.00%	0.00%	0.66%	NA
Aus	269	24.50%	2.60%	2.60%	70.26%	NA
Indica I	595	7.90%	33.30%	2.02%	56.81%	NA
Indica II	465	10.50%	1.90%	1.72%	85.81%	NA
Indica III	913	5.80%	0.50%	1.75%	91.89%	NA
Indica Intermediate	786	12.10%	9.50%	1.15%	77.23%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	98.80%	0.00%	0.00%	1.19%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	66.70%	3.30%	0.00%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916032111	T -> G	LOC_Os09g26520.1	downstream_gene_variant ; 3495.0bp to feature; MODIFIER	silent_mutation	Average:18.696; most accessible tissue: Callus, score: 42.268	N	N	N	N
vg0916032111	T -> G	LOC_Os09g26530.1	intron_variant ; MODIFIER	silent_mutation	Average:18.696; most accessible tissue: Callus, score: 42.268	N	N	N	N
vg0916032111	T -> DEL	N	N	silent_mutation	Average:18.696; most accessible tissue: Callus, score: 42.268	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916032111	NA	6.14E-06	mr1060	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	1.75E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	7.58E-06	NA	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	5.84E-10	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	2.01E-09	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	1.80E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	1.01E-06	mr1173_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	4.08E-06	4.08E-06	mr1173_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	3.74E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	2.31E-13	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	9.67E-07	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	3.40E-07	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	1.20E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	6.41E-06	1.77E-08	mr1452_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	7.10E-07	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	2.56E-08	mr1462_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	2.19E-06	mr1462_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	8.58E-07	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	5.46E-06	mr1470_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	4.29E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	2.79E-07	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	4.79E-11	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	2.61E-07	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	2.93E-07	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	3.63E-06	mr1899_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111	NA	2.73E-07	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251