\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916032111:

Variant ID: vg0916032111 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16032111
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAAGTGCTATGTAATGCCACACACTAAAAAAAGCACAAACTATACCATACAACATAAACATTTCATAAAATACTACTAAGTCTAGAACAGCAACACAA[T/G]
TTATAGAACATTTTCCAAAGCAATAAGCCCCACAAAACATTTTTGGAGTCTACATAAATGATAACTTACCGCTGACATTATTTGCAAAGCACCAATTACA

Reverse complement sequence

TGTAATTGGTGCTTTGCAAATAATGTCAGCGGTAAGTTATCATTTATGTAGACTCCAAAAATGTTTTGTGGGGCTTATTGCTTTGGAAAATGTTCTATAA[A/C]
TTGTGTTGCTGTTCTAGACTTAGTAGTATTTTATGAAATGTTTATGTTGTATGGTATAGTTTGTGCTTTTTTTAGTGTGTGGCATTACATAGCACTTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.60% 6.30% 1.10% 50.99% NA
All Indica  2759 8.80% 10.40% 1.63% 79.12% NA
All Japonica  1512 99.30% 0.00% 0.00% 0.66% NA
Aus  269 24.50% 2.60% 2.60% 70.26% NA
Indica I  595 7.90% 33.30% 2.02% 56.81% NA
Indica II  465 10.50% 1.90% 1.72% 85.81% NA
Indica III  913 5.80% 0.50% 1.75% 91.89% NA
Indica Intermediate  786 12.10% 9.50% 1.15% 77.23% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 98.80% 0.00% 0.00% 1.19% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 66.70% 3.30% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916032111 T -> G LOC_Os09g26520.1 downstream_gene_variant ; 3495.0bp to feature; MODIFIER silent_mutation Average:18.696; most accessible tissue: Callus, score: 42.268 N N N N
vg0916032111 T -> G LOC_Os09g26530.1 intron_variant ; MODIFIER silent_mutation Average:18.696; most accessible tissue: Callus, score: 42.268 N N N N
vg0916032111 T -> DEL N N silent_mutation Average:18.696; most accessible tissue: Callus, score: 42.268 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916032111 NA 6.14E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 1.75E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 7.58E-06 NA mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 5.84E-10 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 2.01E-09 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 1.80E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 1.01E-06 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 4.08E-06 4.08E-06 mr1173_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 3.74E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 2.31E-13 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 9.67E-07 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 3.40E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 1.20E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 6.41E-06 1.77E-08 mr1452_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 7.10E-07 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 2.56E-08 mr1462_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 2.19E-06 mr1462_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 8.58E-07 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 5.46E-06 mr1470_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 4.29E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 2.79E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 4.79E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 2.61E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 2.93E-07 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 3.63E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916032111 NA 2.73E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251