\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916031114:

Variant ID: vg0916031114 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16031114
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCTCATCGATGACCAGGAATCAATGGCATGCCAGGAGAAGCCAACTCATTGCAATTGAAAATGGCTAGCTTGTCCTACCATTTCGTCGATTATAGACC[G/A]
ATGGTGTTGTGAACGGGAGACGACATAATTTGGGGATTACAGCATGAGTAAAGTGGAACAAGAGTAAAGAGCATATCGATTTTAGGAGGTTCCATGCATA

Reverse complement sequence

TATGCATGGAACCTCCTAAAATCGATATGCTCTTTACTCTTGTTCCACTTTACTCATGCTGTAATCCCCAAATTATGTCGTCTCCCGTTCACAACACCAT[C/T]
GGTCTATAATCGACGAAATGGTAGGACAAGCTAGCCATTTTCAATTGCAATGAGTTGGCTTCTCCTGGCATGCCATTGATTCCTGGTCATCGATGAGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.90% 20.70% 3.55% 51.90% NA
All Indica  2759 15.80% 1.30% 2.32% 80.57% NA
All Japonica  1512 33.90% 59.80% 5.56% 0.73% NA
Aus  269 25.30% 0.00% 4.46% 70.26% NA
Indica I  595 37.30% 0.30% 4.03% 58.32% NA
Indica II  465 9.70% 1.10% 3.01% 86.24% NA
Indica III  913 4.30% 0.90% 1.20% 93.65% NA
Indica Intermediate  786 16.70% 2.50% 1.91% 78.88% NA
Temperate Japonica  767 35.90% 55.30% 8.47% 0.39% NA
Tropical Japonica  504 17.90% 78.00% 2.78% 1.39% NA
Japonica Intermediate  241 61.40% 36.10% 2.07% 0.41% NA
VI/Aromatic  96 85.40% 12.50% 0.00% 2.08% NA
Intermediate  90 31.10% 28.90% 8.89% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916031114 G -> DEL N N silent_mutation Average:26.116; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0916031114 G -> A LOC_Os09g26520.1 downstream_gene_variant ; 2498.0bp to feature; MODIFIER silent_mutation Average:26.116; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0916031114 G -> A LOC_Os09g26530.1 intron_variant ; MODIFIER silent_mutation Average:26.116; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916031114 NA 8.99E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 9.17E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 1.37E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 4.59E-06 4.59E-06 mr1302_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 1.46E-07 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 5.62E-06 5.62E-06 mr1418_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 7.10E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 8.91E-06 8.91E-06 mr1506_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 3.50E-06 mr1531_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 1.76E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 1.05E-06 1.05E-06 mr1604_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 6.78E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 2.99E-06 2.99E-06 mr1777_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 7.30E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 5.72E-07 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 2.90E-07 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 9.10E-06 9.10E-06 mr1814_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 3.56E-06 3.56E-06 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 6.73E-06 6.73E-06 mr1831_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 2.46E-06 2.46E-06 mr1840_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 5.35E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 NA 2.05E-06 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916031114 4.39E-06 4.39E-06 mr1934_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251