Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916020326:

Variant ID: vg0916020326 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16020326
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTATTCAACGAGGTAATATTCAATATTTGATTGTCCATCTTATTCGAAAAACTTATAAACAAGTTTTTAAAAAGTAGTCACACATAATGTACTTTCACC[G/A]
TCCTAAAATATACGTATTTTTTTATCCTGACATGGCCTCCGAGATACTACTCTGACCAACAATACCTATAAAAATAAAATATCTTAAATAAAAAGAATTA

Reverse complement sequence

TAATTCTTTTTATTTAAGATATTTTATTTTTATAGGTATTGTTGGTCAGAGTAGTATCTCGGAGGCCATGTCAGGATAAAAAAATACGTATATTTTAGGA[C/T]
GGTGAAAGTACATTATGTGTGACTACTTTTTAAAAACTTGTTTATAAGTTTTTCGAATAAGATGGACAATCAAATATTGAATATTACCTCGTTGAATACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.10%	5.70%	0.13%	52.07%	NA
All Indica	2759	9.60%	9.40%	0.18%	80.75%	NA
All Japonica	1512	99.30%	0.00%	0.00%	0.66%	NA
Aus	269	24.90%	2.20%	0.37%	72.49%	NA
Indica I	595	8.40%	32.90%	0.17%	58.49%	NA
Indica II	465	10.80%	1.90%	0.00%	87.31%	NA
Indica III	913	5.60%	0.10%	0.22%	94.09%	NA
Indica Intermediate	786	14.60%	6.90%	0.25%	78.24%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	98.80%	0.00%	0.00%	1.19%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	66.70%	3.30%	0.00%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916020326	G -> DEL	N	N	silent_mutation	Average:26.562; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0916020326	G -> A	LOC_Os09g26520.1	upstream_gene_variant ; 3416.0bp to feature; MODIFIER	silent_mutation	Average:26.562; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0916020326	G -> A	LOC_Os09g26500.1	downstream_gene_variant ; 4912.0bp to feature; MODIFIER	silent_mutation	Average:26.562; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0916020326	G -> A	LOC_Os09g26510.1	downstream_gene_variant ; 2573.0bp to feature; MODIFIER	silent_mutation	Average:26.562; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0916020326	G -> A	LOC_Os09g26510-LOC_Os09g26520	intergenic_region ; MODIFIER	silent_mutation	Average:26.562; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916020326	NA	3.23E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	2.69E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	5.10E-06	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	1.56E-06	1.48E-17	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	4.82E-12	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	3.40E-09	1.55E-23	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	3.36E-07	1.40E-16	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	2.76E-06	9.91E-16	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	2.60E-11	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	7.90E-06	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	4.60E-06	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	2.11E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	4.24E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	6.38E-15	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	4.60E-10	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	9.23E-24	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	2.70E-15	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	8.63E-17	mr1860_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	3.30E-12	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	3.79E-09	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	3.07E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916020326	NA	7.21E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251