Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915957092:

Variant ID: vg0915957092 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 15957092
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGTCGCCGACTCACTCTCTCTCTCTCTCTCTTCCCAGCTCTCCTCCAAATCATCACAAAATCCTACGTAGAACTACTACCGCCCATTATTGTACCTGT[T/G]
CTTAACATGGACAAACGACAAATAAATTAGTACTCCATCCGTTCCAAAATATAAGAGATTTTGGATGATGTGACATATCCTAATATAATGAATCTGGACA

Reverse complement sequence

TGTCCAGATTCATTATATTAGGATATGTCACATCATCCAAAATCTCTTATATTTTGGAACGGATGGAGTACTAATTTATTTGTCGTTTGTCCATGTTAAG[A/C]
ACAGGTACAATAATGGGCGGTAGTAGTTCTACGTAGGATTTTGTGATGATTTGGAGGAGAGCTGGGAAGAGAGAGAGAGAGAGAGTGAGTCGGCGACTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	8.90%	0.34%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	72.20%	26.90%	0.99%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	97.30%	1.80%	0.91%	0.00%	NA
Tropical Japonica	504	27.60%	71.20%	1.19%	0.00%	NA
Japonica Intermediate	241	85.50%	13.70%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915957092	T -> G	LOC_Os09g26420.1	upstream_gene_variant ; 2232.0bp to feature; MODIFIER	silent_mutation	Average:59.745; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0915957092	T -> G	LOC_Os09g26420.2	upstream_gene_variant ; 2232.0bp to feature; MODIFIER	silent_mutation	Average:59.745; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0915957092	T -> G	LOC_Os09g26420.4	upstream_gene_variant ; 2232.0bp to feature; MODIFIER	silent_mutation	Average:59.745; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0915957092	T -> G	LOC_Os09g26420.5	upstream_gene_variant ; 2232.0bp to feature; MODIFIER	silent_mutation	Average:59.745; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0915957092	T -> G	LOC_Os09g26400-LOC_Os09g26420	intergenic_region ; MODIFIER	silent_mutation	Average:59.745; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915957092	NA	8.15E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	9.50E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	1.95E-07	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	2.38E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	5.60E-06	1.54E-09	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	2.16E-06	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	2.69E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	1.56E-13	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	2.72E-06	mr1562_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	2.63E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	2.76E-11	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	1.36E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	2.70E-09	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	3.72E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	2.62E-07	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	4.71E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	6.18E-07	NA	mr1916_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092	NA	4.08E-11	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251