\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915957092:

Variant ID: vg0915957092 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15957092
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTCGCCGACTCACTCTCTCTCTCTCTCTCTTCCCAGCTCTCCTCCAAATCATCACAAAATCCTACGTAGAACTACTACCGCCCATTATTGTACCTGT[T/G]
CTTAACATGGACAAACGACAAATAAATTAGTACTCCATCCGTTCCAAAATATAAGAGATTTTGGATGATGTGACATATCCTAATATAATGAATCTGGACA

Reverse complement sequence

TGTCCAGATTCATTATATTAGGATATGTCACATCATCCAAAATCTCTTATATTTTGGAACGGATGGAGTACTAATTTATTTGTCGTTTGTCCATGTTAAG[A/C]
ACAGGTACAATAATGGGCGGTAGTAGTTCTACGTAGGATTTTGTGATGATTTGGAGGAGAGCTGGGAAGAGAGAGAGAGAGAGAGTGAGTCGGCGACTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 8.90% 0.34% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 72.20% 26.90% 0.99% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 97.30% 1.80% 0.91% 0.00% NA
Tropical Japonica  504 27.60% 71.20% 1.19% 0.00% NA
Japonica Intermediate  241 85.50% 13.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915957092 T -> G LOC_Os09g26420.1 upstream_gene_variant ; 2232.0bp to feature; MODIFIER silent_mutation Average:59.745; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0915957092 T -> G LOC_Os09g26420.2 upstream_gene_variant ; 2232.0bp to feature; MODIFIER silent_mutation Average:59.745; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0915957092 T -> G LOC_Os09g26420.4 upstream_gene_variant ; 2232.0bp to feature; MODIFIER silent_mutation Average:59.745; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0915957092 T -> G LOC_Os09g26420.5 upstream_gene_variant ; 2232.0bp to feature; MODIFIER silent_mutation Average:59.745; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0915957092 T -> G LOC_Os09g26400-LOC_Os09g26420 intergenic_region ; MODIFIER silent_mutation Average:59.745; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915957092 NA 8.15E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 9.50E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 1.95E-07 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 2.38E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 5.60E-06 1.54E-09 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 2.16E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 2.69E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 1.56E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 2.72E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 2.63E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 2.76E-11 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 1.36E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 2.70E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 3.72E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 2.62E-07 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 4.71E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 6.18E-07 NA mr1916_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915957092 NA 4.08E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251