\
| Variant ID: vg0915747848 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15747848 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 113. )
TCATAGATTAATTAGTCTCAATAGATTCGTCTCGCGAATTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAGTTTT[C/T]
AAATATCCGATGTGATAGGGACTTAAAAGTTTTAAAAGTTTTAGTCCCATCTAAACATAGTCTTTATTAAAAAGAACGGGAAAAGTCCTAACTGGCCAAC
GTTGGCCAGTTAGGACTTTTCCCGTTCTTTTTAATAAAGACTATGTTTAGATGGGACTAAAACTTTTAAAACTTTTAAGTCCCTATCACATCGGATATTT[G/A]
AAAACTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAATTCGCGAGACGAATCTATTGAGACTAATTAATCTATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.00% | 16.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 73.30% | 26.60% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.70% | 39.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 77.40% | 22.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 69.00% | 30.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 47.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915747848 | C -> T | LOC_Os09g26130-LOC_Os09g26144 | intergenic_region ; MODIFIER | silent_mutation | Average:69.282; most accessible tissue: Minghui63 panicle, score: 88.595 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915747848 | NA | 6.39E-06 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747848 | NA | 5.76E-06 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747848 | NA | 1.82E-08 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747848 | NA | 1.56E-08 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747848 | 7.85E-06 | 7.68E-08 | mr1010_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747848 | 5.68E-06 | NA | mr1051_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747848 | NA | 9.33E-09 | mr1051_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747848 | NA | 6.97E-06 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747848 | NA | 5.98E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747848 | NA | 5.59E-12 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747848 | NA | 2.79E-09 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |