\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915747848:

Variant ID: vg0915747848 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15747848
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TCATAGATTAATTAGTCTCAATAGATTCGTCTCGCGAATTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAGTTTT[C/T]
AAATATCCGATGTGATAGGGACTTAAAAGTTTTAAAAGTTTTAGTCCCATCTAAACATAGTCTTTATTAAAAAGAACGGGAAAAGTCCTAACTGGCCAAC

Reverse complement sequence

GTTGGCCAGTTAGGACTTTTCCCGTTCTTTTTAATAAAGACTATGTTTAGATGGGACTAAAACTTTTAAAACTTTTAAGTCCCTATCACATCGGATATTT[G/A]
AAAACTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAATTCGCGAGACGAATCTATTGAGACTAATTAATCTATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 16.90% 0.08% 0.00% NA
All Indica  2759 73.30% 26.60% 0.14% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 60.70% 39.20% 0.17% 0.00% NA
Indica II  465 88.60% 11.40% 0.00% 0.00% NA
Indica III  913 77.40% 22.50% 0.11% 0.00% NA
Indica Intermediate  786 69.00% 30.80% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915747848 C -> T LOC_Os09g26130-LOC_Os09g26144 intergenic_region ; MODIFIER silent_mutation Average:69.282; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915747848 NA 6.39E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915747848 NA 5.76E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915747848 NA 1.82E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915747848 NA 1.56E-08 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915747848 7.85E-06 7.68E-08 mr1010_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915747848 5.68E-06 NA mr1051_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915747848 NA 9.33E-09 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915747848 NA 6.97E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915747848 NA 5.98E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915747848 NA 5.59E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915747848 NA 2.79E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251