\
| Variant ID: vg0915747582 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15747582 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTCTTCTCGTTTAGACATCCAAACTTTAGTATTCCCTTTTTCAACTCATTTTTATCCCCTACTCATTCTCTCTCTGCATGCATTAGGTGGTGTTTGGAT[A/C,T]
CAGGGACTTAACTTTAGTCCCTGTATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTATATAAATGAAAGCTAATTCACGAG
CTCGTGAATTAGCTTTCATTTATATAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATACAGGGACTAAAGTTAAGTCCCTG[T/G,A]
ATCCAAACACCACCTAATGCATGCAGAGAGAGAATGAGTAGGGGATAAAAATGAGTTGAAAAAGGGAATACTAAAGTTTGGATGTCTAAACGAGAAGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 34.00% | 0.36% | 0.02% | T: 4.76% |
| All Indica | 2759 | 97.40% | 1.00% | 0.29% | 0.00% | T: 1.38% |
| All Japonica | 1512 | 1.10% | 98.30% | 0.20% | 0.07% | T: 0.26% |
| Aus | 269 | 32.30% | 1.10% | 0.00% | 0.00% | T: 66.54% |
| Indica I | 595 | 98.80% | 0.80% | 0.17% | 0.00% | T: 0.17% |
| Indica II | 465 | 95.90% | 2.20% | 0.22% | 0.00% | T: 1.72% |
| Indica III | 913 | 98.10% | 0.10% | 0.33% | 0.00% | T: 1.42% |
| Indica Intermediate | 786 | 96.20% | 1.40% | 0.38% | 0.00% | T: 2.04% |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 97.80% | 0.40% | 0.00% | T: 0.20% |
| Japonica Intermediate | 241 | 1.70% | 96.30% | 0.41% | 0.41% | T: 1.24% |
| VI/Aromatic | 96 | 51.00% | 47.90% | 0.00% | 0.00% | T: 1.04% |
| Intermediate | 90 | 43.30% | 46.70% | 6.67% | 0.00% | T: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915747582 | A -> DEL | N | N | silent_mutation | Average:55.178; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0915747582 | A -> T | LOC_Os09g26130-LOC_Os09g26144 | intergenic_region ; MODIFIER | silent_mutation | Average:55.178; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0915747582 | A -> C | LOC_Os09g26130-LOC_Os09g26144 | intergenic_region ; MODIFIER | silent_mutation | Average:55.178; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915747582 | NA | 8.38E-31 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 1.57E-12 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 4.19E-36 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 2.22E-34 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 2.33E-86 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 4.48E-53 | mr1889 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 2.20E-38 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 2.50E-65 | mr1064_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 3.37E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 1.52E-45 | mr1546_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 5.21E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915747582 | NA | 2.12E-62 | mr1733_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |