Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915709539:

Variant ID: vg0915709539 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 15709539
Reference Allele: T	Alternative Allele: G,TGGAG
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATTTATGCTTGACTTAATTTTTTTCATAAATTTTTCGAACAAGACAAACAATCAAACTTGTATAGAGAAATCTACAAATGAACTTATTTTGTGACAGA[T/G,TGGAG]
GGTGTAAATAATTAACACCAAAATTTAAACTTTAATTTATTATCTTTTTCTTAAAGAATGTTTGCGAATAGTTAAAGATAGAGTAGTGTTAAAATATATT

Reverse complement sequence

AATATATTTTAACACTACTCTATCTTTAACTATTCGCAAACATTCTTTAAGAAAAAGATAATAAATTAAAGTTTAAATTTTGGTGTTAATTATTTACACC[A/C,CTCCA]
TCTGTCACAAAATAAGTTCATTTGTAGATTTCTCTATACAAGTTTGATTGTTTGTCTTGTTCGAAAAATTTATGAAAAAAATTAAGTCAAGCATAAATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	35.40%	0.21%	2.22%	TGGAG: 1.33%
All Indica	2759	92.80%	0.90%	0.14%	3.81%	TGGAG: 2.28%
All Japonica	1512	0.70%	99.10%	0.20%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	90.10%	0.70%	0.17%	6.22%	TGGAG: 2.86%
Indica II	465	96.60%	1.90%	0.00%	1.51%	NA
Indica III	913	98.20%	0.20%	0.00%	0.11%	TGGAG: 1.42%
Indica Intermediate	786	86.40%	1.40%	0.38%	7.63%	TGGAG: 4.20%
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.40%	0.60%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	35.60%	61.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915709539	T -> G	LOC_Os09g26110.1	downstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:37.92; most accessible tissue: Callus, score: 83.396	N	N	N	N
vg0915709539	T -> G	LOC_Os09g26100-LOC_Os09g26110	intergenic_region ; MODIFIER	silent_mutation	Average:37.92; most accessible tissue: Callus, score: 83.396	N	N	N	N
vg0915709539	T -> DEL	N	N	silent_mutation	Average:37.92; most accessible tissue: Callus, score: 83.396	N	N	N	N
vg0915709539	T -> TGGAG	LOC_Os09g26110.1	downstream_gene_variant ; 1709.0bp to feature; MODIFIER	silent_mutation	Average:37.92; most accessible tissue: Callus, score: 83.396	N	N	N	N
vg0915709539	T -> TGGAG	LOC_Os09g26100-LOC_Os09g26110	intergenic_region ; MODIFIER	silent_mutation	Average:37.92; most accessible tissue: Callus, score: 83.396	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915709539	NA	2.31E-32	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915709539	NA	5.61E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915709539	NA	6.73E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915709539	NA	2.73E-14	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915709539	NA	1.73E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915709539	NA	9.99E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915709539	NA	1.37E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915709539	NA	7.60E-38	mr1723_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915709539	NA	5.28E-07	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251