Variant ID: vg0915709539 (JBrowse) | Variation Type: INDEL |
Chromosome: chr09 | Position: 15709539 |
Reference Allele: T | Alternative Allele: G,TGGAG |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAATTTATGCTTGACTTAATTTTTTTCATAAATTTTTCGAACAAGACAAACAATCAAACTTGTATAGAGAAATCTACAAATGAACTTATTTTGTGACAGA[T/G,TGGAG]
GGTGTAAATAATTAACACCAAAATTTAAACTTTAATTTATTATCTTTTTCTTAAAGAATGTTTGCGAATAGTTAAAGATAGAGTAGTGTTAAAATATATT
AATATATTTTAACACTACTCTATCTTTAACTATTCGCAAACATTCTTTAAGAAAAAGATAATAAATTAAAGTTTAAATTTTGGTGTTAATTATTTACACC[A/C,CTCCA]
TCTGTCACAAAATAAGTTCATTTGTAGATTTCTCTATACAAGTTTGATTGTTTGTCTTGTTCGAAAAATTTATGAAAAAAATTAAGTCAAGCATAAATTA
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 60.80% | 35.40% | 0.21% | 2.22% | TGGAG: 1.33% |
All Indica | 2759 | 92.80% | 0.90% | 0.14% | 3.81% | TGGAG: 2.28% |
All Japonica | 1512 | 0.70% | 99.10% | 0.20% | 0.00% | NA |
Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 90.10% | 0.70% | 0.17% | 6.22% | TGGAG: 2.86% |
Indica II | 465 | 96.60% | 1.90% | 0.00% | 1.51% | NA |
Indica III | 913 | 98.20% | 0.20% | 0.00% | 0.11% | TGGAG: 1.42% |
Indica Intermediate | 786 | 86.40% | 1.40% | 0.38% | 7.63% | TGGAG: 4.20% |
Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 1.00% | 98.40% | 0.60% | 0.00% | NA |
Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 35.60% | 61.10% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0915709539 | T -> G | LOC_Os09g26110.1 | downstream_gene_variant ; 1710.0bp to feature; MODIFIER | silent_mutation | Average:37.92; most accessible tissue: Callus, score: 83.396 | N | N | N | N |
vg0915709539 | T -> G | LOC_Os09g26100-LOC_Os09g26110 | intergenic_region ; MODIFIER | silent_mutation | Average:37.92; most accessible tissue: Callus, score: 83.396 | N | N | N | N |
vg0915709539 | T -> DEL | N | N | silent_mutation | Average:37.92; most accessible tissue: Callus, score: 83.396 | N | N | N | N |
vg0915709539 | T -> TGGAG | LOC_Os09g26110.1 | downstream_gene_variant ; 1709.0bp to feature; MODIFIER | silent_mutation | Average:37.92; most accessible tissue: Callus, score: 83.396 | N | N | N | N |
vg0915709539 | T -> TGGAG | LOC_Os09g26100-LOC_Os09g26110 | intergenic_region ; MODIFIER | silent_mutation | Average:37.92; most accessible tissue: Callus, score: 83.396 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0915709539 | NA | 2.31E-32 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915709539 | NA | 5.61E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915709539 | NA | 6.73E-12 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915709539 | NA | 2.73E-14 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915709539 | NA | 1.73E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915709539 | NA | 9.99E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915709539 | NA | 1.37E-07 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915709539 | NA | 7.60E-38 | mr1723_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915709539 | NA | 5.28E-07 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |