\
| Variant ID: vg0915695679 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15695679 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTTGCAGCGGTTACACCTGACATGTGGGCCCTCCTTATCCATTTGCTTGCTTAGGAGTGAGGTTTTCTCCACTTTCTCTTTATTTTATATGATAAATTC[C/T]
TGCAACATGTTATTCTCCAAATTCAAGTGGAAATATATTATTTGAAAACAAACATGCATTGTAAGCATAGCTAATTCTCCATTATTTTAGTTATATTGGC
GCCAATATAACTAAAATAATGGAGAATTAGCTATGCTTACAATGCATGTTTGTTTTCAAATAATATATTTCCACTTGAATTTGGAGAATAACATGTTGCA[G/A]
GAATTTATCATATAAAATAAAGAGAAAGTGGAGAAAACCTCACTCCTAAGCAAGCAAATGGATAAGGAGGGCCCACATGTCAGGTGTAACCGCTGCAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 1.70% | 2.86% | 0.00% | NA |
| All Indica | 2759 | 92.40% | 2.80% | 4.86% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 72.60% | 10.10% | 17.31% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.10% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.00% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 1.50% | 2.93% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915695679 | C -> T | LOC_Os09g26090.1 | upstream_gene_variant ; 1814.0bp to feature; MODIFIER | silent_mutation | Average:49.94; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| vg0915695679 | C -> T | LOC_Os09g26100.1 | upstream_gene_variant ; 3123.0bp to feature; MODIFIER | silent_mutation | Average:49.94; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| vg0915695679 | C -> T | LOC_Os09g26080.1 | downstream_gene_variant ; 3074.0bp to feature; MODIFIER | silent_mutation | Average:49.94; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| vg0915695679 | C -> T | LOC_Os09g26090-LOC_Os09g26100 | intergenic_region ; MODIFIER | silent_mutation | Average:49.94; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915695679 | NA | 4.31E-14 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | NA | 1.19E-08 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | NA | 1.92E-13 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | NA | 3.91E-09 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | NA | 2.37E-09 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | NA | 1.33E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | NA | 1.45E-15 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | NA | 1.67E-09 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | 2.35E-06 | 1.16E-19 | mr1728_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | NA | 5.36E-12 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | NA | 2.61E-12 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915695679 | NA | 1.13E-08 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |