\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915695679:

Variant ID: vg0915695679 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15695679
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTGCAGCGGTTACACCTGACATGTGGGCCCTCCTTATCCATTTGCTTGCTTAGGAGTGAGGTTTTCTCCACTTTCTCTTTATTTTATATGATAAATTC[C/T]
TGCAACATGTTATTCTCCAAATTCAAGTGGAAATATATTATTTGAAAACAAACATGCATTGTAAGCATAGCTAATTCTCCATTATTTTAGTTATATTGGC

Reverse complement sequence

GCCAATATAACTAAAATAATGGAGAATTAGCTATGCTTACAATGCATGTTTGTTTTCAAATAATATATTTCCACTTGAATTTGGAGAATAACATGTTGCA[G/A]
GAATTTATCATATAAAATAAAGAGAAAGTGGAGAAAACCTCACTCCTAAGCAAGCAAATGGATAAGGAGGGCCCACATGTCAGGTGTAACCGCTGCAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 1.70% 2.86% 0.00% NA
All Indica  2759 92.40% 2.80% 4.86% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 72.60% 10.10% 17.31% 0.00% NA
Indica II  465 98.10% 1.10% 0.86% 0.00% NA
Indica III  913 99.60% 0.00% 0.44% 0.00% NA
Indica Intermediate  786 95.50% 1.50% 2.93% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915695679 C -> T LOC_Os09g26090.1 upstream_gene_variant ; 1814.0bp to feature; MODIFIER silent_mutation Average:49.94; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0915695679 C -> T LOC_Os09g26100.1 upstream_gene_variant ; 3123.0bp to feature; MODIFIER silent_mutation Average:49.94; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0915695679 C -> T LOC_Os09g26080.1 downstream_gene_variant ; 3074.0bp to feature; MODIFIER silent_mutation Average:49.94; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0915695679 C -> T LOC_Os09g26090-LOC_Os09g26100 intergenic_region ; MODIFIER silent_mutation Average:49.94; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915695679 NA 4.31E-14 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 NA 1.19E-08 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 NA 1.92E-13 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 NA 3.91E-09 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 NA 2.37E-09 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 NA 1.33E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 NA 1.45E-15 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 NA 1.67E-09 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 2.35E-06 1.16E-19 mr1728_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 NA 5.36E-12 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 NA 2.61E-12 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915695679 NA 1.13E-08 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251