\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915690278:

Variant ID: vg0915690278 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15690278
Reference Allele: TAlternative Allele: G,C
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGACCTTGTCAGGTATAAAGCTAGTTATCCTCTTGTTGCTCGCATCTAGTTACCCTCTTGTGTTCGGTTTACGCTGGCACTCTCTGTCTTGAACCTAC[T/G,C]
GCCATGAAGATCGGGCCACCCCTCGCGAGTGTGTTCGCATCATATGGTATCGGAGCTTTCGTTGACACGGTAGGTTTATCATCCACATATCAACCTTGTT

Reverse complement sequence

AACAAGGTTGATATGTGGATGATAAACCTACCGTGTCAACGAAAGCTCCGATACCATATGATGCGAACACACTCGCGAGGGGTGGCCCGATCTTCATGGC[A/C,G]
GTAGGTTCAAGACAGAGAGTGCCAGCGTAAACCGAACACAAGAGGGTAACTAGATGCGAGCAACAAGAGGATAACTAGCTTTATACCTGACAAGGTCGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.30% 5.30% 0.38% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 83.10% 15.90% 1.06% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 97.80% 2.00% 0.26% 0.00% NA
Tropical Japonica  504 59.10% 38.70% 2.18% 0.00% NA
Japonica Intermediate  241 86.30% 12.40% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915690278 T -> G LOC_Os09g26080.1 upstream_gene_variant ; 727.0bp to feature; MODIFIER silent_mutation Average:50.847; most accessible tissue: Callus, score: 63.998 N N N N
vg0915690278 T -> G LOC_Os09g26070.1 downstream_gene_variant ; 802.0bp to feature; MODIFIER silent_mutation Average:50.847; most accessible tissue: Callus, score: 63.998 N N N N
vg0915690278 T -> G LOC_Os09g26090.1 downstream_gene_variant ; 2619.0bp to feature; MODIFIER silent_mutation Average:50.847; most accessible tissue: Callus, score: 63.998 N N N N
vg0915690278 T -> G LOC_Os09g26070-LOC_Os09g26080 intergenic_region ; MODIFIER silent_mutation Average:50.847; most accessible tissue: Callus, score: 63.998 N N N N
vg0915690278 T -> C LOC_Os09g26080.1 upstream_gene_variant ; 727.0bp to feature; MODIFIER N Average:50.847; most accessible tissue: Callus, score: 63.998 N N N N
vg0915690278 T -> C LOC_Os09g26070.1 downstream_gene_variant ; 802.0bp to feature; MODIFIER N Average:50.847; most accessible tissue: Callus, score: 63.998 N N N N
vg0915690278 T -> C LOC_Os09g26090.1 downstream_gene_variant ; 2619.0bp to feature; MODIFIER N Average:50.847; most accessible tissue: Callus, score: 63.998 N N N N
vg0915690278 T -> C LOC_Os09g26070-LOC_Os09g26080 intergenic_region ; MODIFIER N Average:50.847; most accessible tissue: Callus, score: 63.998 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915690278 NA 2.74E-10 mr1156 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915690278 NA 4.44E-09 mr1179 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915690278 NA 6.61E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251